Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN53164

FASTA Sequence
Unigene ID: UN53164Length: 346 SSR 
TAGCTGAGCAAAATCATCATCTGATTCATCGTCATCATCATCATCATGATTGATGCTGACTAGCTGAGCTGGAGGAGGAGGAGGAG
TTGTTGTGCTGCTTTCATTTGAAGGAACAGAGGCGATATCGTCGTGACGCTGGAGAACACGCTGCAAGTTATCGTTCAATGCCAAT
CCCTGGCACAGAAGCTCCTCGTCTGTTGTGGTGTTGACAAGAGTCATAACACGTTTTTGATAAGTACGACATTGCTCAACTAAATC
AACTATAAGCTCTTCTTTCAAACCATCGGCGGAATCAAGTGCTCCGAGAATGTCCATCAAACATCAACAGATCCCTCAGCACTCTG
AT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAC00635 Unknown protein [Arabidopsis thaliana]3867e-036
NP_177823 Target of Myb protein 1 [Arabidopsis thaliana]3867e-036
XP_002889114 VHS domain-containing protein [Arabidopsis lyrata subsp. lyrata]3867e-036
NP_564138 Target of Myb protein 1 [Arabidopsis thaliana]3642e-033
XP_002893160 VHS domain-containing protein [Arabidopsis lyrata subsp. lyrata]3633e-033

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
O49283 F22K20.7 protein3864e-036
Q6NQK0 At1g769703864e-036
Q9LPL6 F24J8.3 protein3642e-033
B9S2Q1 Protein transporter, putative3336e-030
B9H7L0 Predicted protein2996e-026

Arabidopsis top hits (Blast detail)Scoree value
AT1G76970.1 VHS domain-containing protein / GAT domain-containing protein3862e-038
AT1G21380.1 VHS domain-containing protein / GAT domain-containing protein3646e-036
AT3G08790.1 VHS domain-containing protein / GAT domain-containing protein2302e-020
AT4G32760.1 protein transporter2185e-019
AT5G01760.1 VHS domain-containing protein / GAT domain-containing protein1854e-015

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members