Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN53206

FASTA Sequence
Unigene ID: UN53206Length: 375 SSR 
TCAATTCAAACTCCATTTAAACAAAAAGACCATATTCTAAGAATCACCACATAAAGAGAAAGAAAACTTACAATGACAATGAAACT
AAAGATTGTATTTTCATTAAACAAAGACAAAATAAAAAGTAAATGAAGATGATATTAAAGAGTTCACAAAAGAAAAGACTTGTCTT
ATGCCAGCAAACTAGGCAATCCCTGACCTGCGCAGCTCTGCTTCCCCGTGTGCAAAGTGACATCTATCCCCAAACGTACAGTTCCC
TTTCGCGAATCTCTCGCACATCTTCGTCTTGAAGTTGCTCCCTGGATGCGGTTTCCCTTCGGAACCAACCCCCCCACCACCAAGAC
CACCACCACCACCACCACCAGGTGGTCTCCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAB01961 unnamed protein product [Arabidopsis thaliana]2952e-025
NP_566412 zinc finger CCCH domain-containing protein 36 [Arabidopsis thaliana]2952e-025
BAJ34617 unnamed protein product [Thellungiella halophila]2891e-024
XP_002884884 KH domain-containing protein [Arabidopsis lyrata subsp. lyrata]2792e-023
XP_002873278 KH domain-containing protein [Arabidopsis lyrata subsp. lyrata]2362e-018

Swiss-Prot top hits (Blast detail)Scoree value
Q9C7C3 Zinc finger CCCH domain-containing protein 362958e-027
Q9FG30 Zinc finger CCCH domain-containing protein 522331e-019
Q7F8R0 Zinc finger CCCH domain-containing protein 141882e-014
Q69XQ3 Zinc finger CCCH domain-containing protein 441765e-013
Q7XPK1 Zinc finger CCCH domain-containing protein 311676e-012

TrEMBL top hits (Blast detail)Scoree value
B9T5D9 Putative uncharacterized protein1956e-014
B9T5D8 Putative uncharacterized protein1948e-014
A2X1Z0 Putative uncharacterized protein1884e-013
C6T9Y5 Putative uncharacterized protein1841e-012
C6T6Y4 Putative uncharacterized protein1822e-012

Arabidopsis top hits (Blast detail)Scoree value
AT3G12130.1 KH domain-containing protein / zinc finger (CCCH type) family protein2968e-028
AT5G06770.1 KH domain-containing protein / zinc finger (CCCH type) family protein2341e-020
AT1G32360.1 zinc finger (CCCH-type) family protein1328e-009
AT3G19360.1 zinc finger (CCCH-type) family protein1103e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members