|
Information for unigene UN55129
FASTA Sequence |
Unigene ID: UN55129 | Length: 239 |
SSR | | CCTTTATTTGATGCTCCTCCGTCTCTCGGCTCTTCGCTCTATCCGTCGTTTCACATCTTCTTCTTCTTCTTACTCTTCTCATTCCC
CCTCTTCGAGCAGATCCAAGCCAACCAGCTCGAGAAGCTCAAGTCTCTCCCCCACGATCCAATCAAGATTACGTTGCCAGATGGGA
CAGTGAAAGAAGGGAAGAAGTGGGAGACGACTCCGATGGACATCGCGGCTGGGATTTCCAAGGGTTT
|
|
|
GenBank top hits (Blast detail) | Score | e value |
NP_198035 threonyl-tRNA synthetase [Arabidopsis thaliana] | 241 | 5e-019 |
AAB61048 Similar to threonyl-tRNA synthetase; coded for by A. thaliana cDNA R65376 [Arabidopsis thaliana] | 241 | 5e-019 |
AAK82468 AT5g26830/F2P16_90 [Arabidopsis thaliana] | 241 | 5e-019 |
CAA74705 threonyl-tRNA synthetase [Arabidopsis thaliana] | 241 | 5e-019 |
XP_002872240 AT5g26830/F2P16_90 [Arabidopsis lyrata subsp. lyrata] | 238 | 1e-018 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O04630 Threonyl-tRNA synthetase, mitochondrial | 241 | 2e-020 |
Q8GZ45 Probable threonyl-tRNA synthetase, cytoplasmic | 191 | 1e-014 |
P04801 Threonyl-tRNA synthetase, cytoplasmic | 146 | 2e-009 |
P87144 Threonyl-tRNA synthetase, cytoplasmic | 140 | 9e-009 |
Q54J66 Probable threonyl-tRNA synthetase 1, cytoplasmic | 134 | 4e-008 |
TrEMBL top hits (Blast detail) | Score | e value |
B9HJR1 Predicted protein | 189 | 4e-013 |
C5KKF8 Threonyl-tRNA synthetase, putative | 171 | 4e-011 |
C5KKF9 Threonyl-tRNA synthetase, putative | 171 | 4e-011 |
C5LI66 Threonyl-tRNA synthetase, putative | 171 | 4e-011 |
B9S4M4 Threonyl-tRNA synthetase, putative | 166 | 2e-010 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT5G26830.1 threonyl-tRNA synthetase / threonine--tRNA ligase (THRRS) | 241 | 1e-021 |
AT1G17960.1 threonyl-tRNA synthetase, putative / threonine--tRNA ligase, putative | 191 | 8e-016 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
|
|
|