Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN55228

FASTA Sequence
Unigene ID: UN55228Length: 333 SSR 
GGACTCCTCCATTCGATAAATCGCAGAAGAAACGAAACGCCTCTAAAAGGTTTCTAGAGAGAGAGAGTTATGGCGTCAGCTGATAC
AGGAGAACCGGAGTATGAGAGTGATCCCGAGGAGCTGAAGCGCTCTTTGGCTACTCGGAGGAGAGAAGCTAGCGATGACGAAGAGG
AAGATGACGTTAGTGGTGGTGGTGGCGAAGGAATTAAAAACCGTAGGGCTGAGATCGATTCCGATGCCGACCAGTCCGATGAACAG
GATGGTGCTGCTGTGGAGAATGATAATGACGAAAACAAGAGCGATGATGGAGAGGAGAGTTACGACGAGGAGGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002890097 glycine-rich protein [Arabidopsis lyrata subsp. lyrata]1922e-013
AAD39656 ESTs gb|R90323, gb|R90338. gb|Z25504 and gb|AA651448 come from this gene [Arabidopsis thaliana]1913e-013
NP_850944 CASC3/Barentsz eIF4AIII binding protein [Arabidopsis thaliana]1913e-013
AAL87253 unknown protein [Arabidopsis thaliana]1913e-013
NP_172980 CASC3/Barentsz eIF4AIII binding protein [Arabidopsis thaliana]1913e-013

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8H1F3 Putative uncharacterized protein At1g152801912e-013
Q8RXP2 Putative uncharacterized protein At1g152801912e-013
Q9XI41 F9L1.22 protein1912e-013
B9SQA8 Putative uncharacterized protein1652e-010
Q93ZJ9 AT1G80000 protein1437e-008

Arabidopsis top hits (Blast detail)Scoree value
AT1G15280.1 glycine-rich protein1917e-016
AT1G15280.2 glycine-rich protein1917e-016
AT1G80000.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT1G15280.2); Has 2243 Blast hits to 1704 proteins in 212 species: Archae - 16; Bacteria - 151; Metazoa - 691; Fungi - 281; Plants - 163; Viruses - 64; Other Eukaryotes - 877 (source: NCBI BLink).1433e-010
AT1G80000.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: CASC3/Barentsz eIF4AIII binding (InterPro:IPR018545); BEST Arabidopsis thaliana protein match is: glycine-rich protein (TAIR:AT1G15280.2); Has 2243 Blast hits to 1704 proteins in 212 species: Archae - 16; Bacteria - 151; Metazoa - 691; Fungi - 281; Plants - 163; Viruses - 64; Other Eukaryotes - 877 (source: NCBI BLink).1433e-010
AT2G34300.1 dehydration-responsive protein-related1057e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  100%

Unigene Members