Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN55584

FASTA Sequence
Unigene ID: UN55584Length: 596 SSR 
GAAGGTTTTAAACTTGGAATTAAGATCCGACAACAGTGTAGATAATGAAGCTGAGATTTCCAAAAACACTAATTGCCAATCCAAAA
TACAAAAAGAAAAAAAGACACGCAGATAAATACTCTGCGTTGATACCACTGCTTTAGGTAGCAGACAAATGCTGCAATGACTCTGC
CTCAACCCATGAAATAAGATTATGTCTCTGCTCGCTCACAGGTTCCCTACTGGTTCCACAGGGTGAATCAGCAGCAGTAACACATC
GGCGGCTAACTCCCCATCGTTTCTGTGGCACAGACTTTGTTTTAGGTGAAATCTCTCTGAACTAGTAACCTGAAGATGCTCCTAGA
CCTTTGGCGAGCCACTGGTTTTGGTGAGGGCTGAGGAGAAGGTTGATCGTGTGACCACATAGATTCCGTCATCTTCAAATTCACAT
CGAATCCATATTAGATGCTAAATCTGAGATCTCTGTGGCAATACACGCCAATTCGCCCCGATCTAAATTTTCCTAATTTCCTCGGC
GGCGGCGGCGGTGGCGGCTCCGACCTCAACGTGATGGGTTCGATTTCTGATGAAGAGGAGGGACGAAGAAACCTAAAAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002892199 transducin family protein [Arabidopsis lyrata subsp. lyrata]2095e-015
NP_849587 transducin/WD-40 repeat-containing protein [Arabidopsis thaliana]1952e-013
NP_563703 transducin/WD-40 repeat-containing protein [Arabidopsis thaliana]1952e-013
AAC16752 Contains similarity to neural cell adhesion molecule 2, large isoform precursor gb|M76710 from Xenopus laevis, and beta transducin from S. cerevisiae gb|Q05946. ESTs gb|N65081 gb|Z30910, gb|Z34190, gb|Z34611, gb|R30101, gb|H36304, and gb|N65606 come from this gene [Arabidopsis thaliana]1819e-012
XP_002865395 transducin family protein [Arabidopsis lyrata subsp. lyrata]1665e-010

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q94C94 Putative uncharacterized protein At1g041401951e-013
O64493 F20D22.9 protein1816e-012
Q93XZ2 AT5G43930 protein1654e-010
B9T5V8 Nucleotide binding protein, putative1289e-006

Arabidopsis top hits (Blast detail)Scoree value
AT1G04140.1 transducin family protein / WD-40 repeat family protein1951e-015
AT1G04140.2 transducin family protein / WD-40 repeat family protein1951e-015
AT5G43930.1 transducin family protein / WD-40 repeat family protein1653e-012
AT5G43930.2 transducin family protein / WD-40 repeat family protein1653e-012
AT5G43930.3 transducin family protein / WD-40 repeat family protein1653e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  100%

Unigene Members