Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN55973

FASTA Sequence
Unigene ID: UN55973Length: 508 SSR 
CCTCCTCGTCTCCCGATTCGCACTTCTTTTCGTTGGTTAGGGTTTGGAAATTGCTCAGGATGGGTCAGATCGAGTACTCCGATAAA
TACTTCGATGATACTTACGAGTACAGGCACGTGGTTCTTCCTCCGGAGGTTGCTAAGCTTCTACCTAAATCGTATTCTCTCCGAAA
GTGAATGGAGGGCAATAGGAGTGCAGCAAAGCCGTGGATGGGTCCATTACGCTATTCATCGCCCTGAGCCACACATCATGCTCTTC
AAGCGGACTCTCAACTACCAACCTCCAACTAATCCCATTCCCAAGCACTAGTAGACTCCAAATATTCCCTCTCTCTAAAACTACGA
TTTGGTTTATGTCTCTCTCGTAAACAAACAAACAAACAAACACTCTCCGTTACACTCCCCCTTGTTGGCTGGCTCTTTTTTTTTTT
ATTTATTATCATCTGTGTTCTTGAATTCTCTTCAGTGGAGAATTTGTTTGCGTCCACTTTATTATGTTTTGCATCTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_180364 cyclin-dependent kinases regulatory subunit 2 [Arabidopsis thaliana]2211e-016
XP_002331485 regulatory subunit of cyclin-dependent kinase [Populus trichocarpa]2165e-016
AAS13367 cyclin-dependent kinases regulatory subunit [Glycine max]2165e-016
AAS79576 putative CDK regulatory subunit [Ipomoea trifida]2165e-016
BAF36296 hypothetical protein [Ipomoea trifida]2165e-016

Swiss-Prot top hits (Blast detail)Scoree value
Q9SJJ5 Cyclin-dependent kinases regulatory subunit 22217e-018
O23249 Cyclin-dependent kinases regulatory subunit 12154e-017
A2XCH8 Cyclin-dependent kinases regulatory subunit 12128e-017
Q6PS57 Cyclin-dependent kinases regulatory subunit 12128e-017
P55933 Probable cyclin-dependent kinases regulatory subunit1795e-013

TrEMBL top hits (Blast detail)Scoree value
A0A8Z1 Putative uncharacterized protein2164e-016
A5AEC1 Putative uncharacterized protein2164e-016
A9NIV3 Cyclin-dependent kinases regulatory subunit2164e-016
A9PHZ5 Putative uncharacterized protein2164e-016
A9PJZ4 Putative uncharacterized protein2164e-016

Arabidopsis top hits (Blast detail)Scoree value
AT2G27970.1 CKS2 (CDK-subunit 2); cyclin-dependent protein kinase/ cyclin-dependent protein kinase regulator2218e-019
AT2G27960.1 CKS1 (CYCLIN-DEPENDENT KINASE-SUBUNIT 1); cyclin-dependent protein kinase/ protein binding2154e-018

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  100%

Unigene Members