Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN57017

FASTA Sequence
Unigene ID: UN57017Length: 426 SSR 
ATCGCGGATGGTTTCCGCTTGATCTTGGACGACCAAACCTTCGTCTTCTTCTAGGAACATGATTCGAACCATCACCTGTTTCGTTC
TGTAAACGCAACCCTTCACCATCATCATCATCATCATTGTCTTCATCTTGTAAACCCAATAAATTCTCCCCCCAAAGATAACGCCT
ATCTGAAAAAAAACGGCGATGAGTGTTCCTCCAAGCCCTCGACCTGTGAGATCTTGATCCACCACCACCACTGCCACTACCACTAA
ACCCTCCGTTATTTTCAAGAAATCCAATCATCTGAAACAACACGAAAGTAGTCCAAATGTCGCTGTTGTTGCTGTTGCCGCCGCCT
CCATTTCCGGCTTCCCTCTCACCTGGGAACCTATCTCCGTTTTCGATAACGTAGTCTCCTACAACAACAGCACCGGGCATGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002883554 hypothetical protein ARALYDRAFT_479993 [Arabidopsis lyrata subsp. lyrata]5131e-050
NP_189118 uncharacterized protein [Arabidopsis thaliana]5093e-050
BAH56910 AT3G24740 [Arabidopsis thaliana]5093e-050
XP_002301572 predicted protein [Populus trichocarpa]2835e-024
XP_002265815 PREDICTED: hypothetical protein [Vitis vinifera]2272e-017

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
C0Z2I1 AT3G24740 protein5092e-050
Q9LRY5 AT3g24740/K7P8_35092e-050
B9GTE6 Predicted protein2834e-024
B9S551 Putative uncharacterized protein1696e-011
B6T7N4 Putative uncharacterized protein1428e-008

Arabidopsis top hits (Blast detail)Scoree value
AT3G24740.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G25910.1); Has 135 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).4832e-049
AT3G24740.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1644 (InterPro:IPR012866); BEST Arabidopsis thaliana protein match is: zinc ion binding (TAIR:AT3G25910.1); Has 135 Blast hits to 134 proteins in 7 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 135; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).4832e-049

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members