 |
Information for unigene UN57282
FASTA Sequence |
Unigene ID: UN57282 | Length: 678 |
SSR | | GGAAGTTCTCTTTTATAGTTGTGTGTGTTGTGTTGTGTTGTGTTGTGTTGTGTGCACTGCTCTATTGTTCAGCAGTTTGAGCCAAA
TCACAAGAACCCTACCAATAAAGTCAGTGACTCAAATGAGACCATAATCACTGTAATAACCAAACAGATGAATGAAACCTTTCTTA
GCCTCTCTACTAGAGAGCTCTCTCCACTCCCTCCAAAAGCTCTCCTCCACTCACTCCCACGCCATCAAACACGGTTACATCTCAGA
CGTCTACGTATCCAACAGAGTCCTAGACTCCTACATAAAATCAGGCTTCCTGGGTCACGCCCACAACCTGTTCGACGAAATGCCTC
ACAGAGACACAGTCTCTTGGAACACGATGATATCCGGATACACAAGCTCCGGGAAGCTAGACAACGCGTGGTTCCTGTTCACATGT
ATGAGAAGGTATGGTTCTGACCCTGATGGGTATAGTTTCAGTAGGCTGTTGAAAGGTGTTGCTTCTGCGAAAAGGTTTGATCTTGG
GGAGCAAGTTCATGCTTTGGTTGTAAAGGGAGGTTACGAGAGTAATAACGTCTACGTTGGGAGTGCGCTTGTTGACATGTACGCGA
AATGCGAGAGAGTTGAGGATGCTTTGGAGCGTTTGGGGAGATTTGGGAGCCTAACTCTGTTTCTTGGACGCTCTGA
|
|
|
GenBank top hits (Blast detail) | Score | e value |
BAB01060 unnamed protein product [Arabidopsis thaliana] | 642 | 4e-065 |
NP_189226 pentatricopeptide repeat-containing protein [Arabidopsis thaliana] | 642 | 4e-065 |
XP_002310370 predicted protein [Populus trichocarpa] | 435 | 4e-041 |
XP_002533336 pentatricopeptide repeat-containing protein, putative [Ricinus communis] | 432 | 1e-040 |
XP_002876941 predicted protein [Arabidopsis lyrata subsp. lyrata] | 423 | 1e-039 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q9LU94 Putative pentatricopeptide repeat-containing protein At3g25970 | 642 | 2e-066 |
Q9SVA5 Pentatricopeptide repeat-containing protein At4g39530 | 272 | 2e-023 |
Q9FGL1 Putative pentatricopeptide repeat-containing protein At5g47460 | 270 | 3e-023 |
Q9SMZ2 Pentatricopeptide repeat-containing protein At4g33170 | 265 | 1e-022 |
Q9LIQ7 Pentatricopeptide repeat-containing protein At3g24000, mitochondrial | 255 | 2e-021 |
TrEMBL top hits (Blast detail) | Score | e value |
B9HGA1 Predicted protein | 435 | 3e-041 |
B9T517 Pentatricopeptide repeat-containing protein, putative | 432 | 7e-041 |
A5ATQ0 Putative uncharacterized protein | 368 | 2e-033 |
Q2A9N8 PPR repeat containing protein | 295 | 5e-025 |
B9II40 Predicted protein | 279 | 4e-023 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT3G25970.1 pentatricopeptide (PPR) repeat-containing protein | 446 | 1e-044 |
AT4G39530.1 pentatricopeptide (PPR) repeat-containing protein | 272 | 2e-024 |
AT5G47460.1 pentatricopeptide (PPR) repeat-containing protein | 270 | 3e-024 |
AT4G33170.1 pentatricopeptide (PPR) repeat-containing protein | 265 | 1e-023 |
AT3G24000.1 INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, carpel; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 15874 Blast hits to 5333 proteins in 187 species: Archae - 1; Bacteria - 6; Metazoa - 100; Fungi - 81; Plants - 15349; Viruses - 0; Other Eukaryotes - 337 (source: NCBI BLink). | 255 | 1e-022 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
 |
|
|