Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN57282

FASTA Sequence
Unigene ID: UN57282Length: 678 SSR 
GGAAGTTCTCTTTTATAGTTGTGTGTGTTGTGTTGTGTTGTGTTGTGTTGTGTGCACTGCTCTATTGTTCAGCAGTTTGAGCCAAA
TCACAAGAACCCTACCAATAAAGTCAGTGACTCAAATGAGACCATAATCACTGTAATAACCAAACAGATGAATGAAACCTTTCTTA
GCCTCTCTACTAGAGAGCTCTCTCCACTCCCTCCAAAAGCTCTCCTCCACTCACTCCCACGCCATCAAACACGGTTACATCTCAGA
CGTCTACGTATCCAACAGAGTCCTAGACTCCTACATAAAATCAGGCTTCCTGGGTCACGCCCACAACCTGTTCGACGAAATGCCTC
ACAGAGACACAGTCTCTTGGAACACGATGATATCCGGATACACAAGCTCCGGGAAGCTAGACAACGCGTGGTTCCTGTTCACATGT
ATGAGAAGGTATGGTTCTGACCCTGATGGGTATAGTTTCAGTAGGCTGTTGAAAGGTGTTGCTTCTGCGAAAAGGTTTGATCTTGG
GGAGCAAGTTCATGCTTTGGTTGTAAAGGGAGGTTACGAGAGTAATAACGTCTACGTTGGGAGTGCGCTTGTTGACATGTACGCGA
AATGCGAGAGAGTTGAGGATGCTTTGGAGCGTTTGGGGAGATTTGGGAGCCTAACTCTGTTTCTTGGACGCTCTGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAB01060 unnamed protein product [Arabidopsis thaliana]6424e-065
NP_189226 pentatricopeptide repeat-containing protein [Arabidopsis thaliana]6424e-065
XP_002310370 predicted protein [Populus trichocarpa]4354e-041
XP_002533336 pentatricopeptide repeat-containing protein, putative [Ricinus communis]4321e-040
XP_002876941 predicted protein [Arabidopsis lyrata subsp. lyrata]4231e-039

Swiss-Prot top hits (Blast detail)Scoree value
Q9LU94 Putative pentatricopeptide repeat-containing protein At3g259706422e-066
Q9SVA5 Pentatricopeptide repeat-containing protein At4g395302722e-023
Q9FGL1 Putative pentatricopeptide repeat-containing protein At5g474602703e-023
Q9SMZ2 Pentatricopeptide repeat-containing protein At4g331702651e-022
Q9LIQ7 Pentatricopeptide repeat-containing protein At3g24000, mitochondrial2552e-021

TrEMBL top hits (Blast detail)Scoree value
B9HGA1 Predicted protein4353e-041
B9T517 Pentatricopeptide repeat-containing protein, putative4327e-041
A5ATQ0 Putative uncharacterized protein3682e-033
Q2A9N8 PPR repeat containing protein2955e-025
B9II40 Predicted protein2794e-023

Arabidopsis top hits (Blast detail)Scoree value
AT3G25970.1 pentatricopeptide (PPR) repeat-containing protein4461e-044
AT4G39530.1 pentatricopeptide (PPR) repeat-containing protein2722e-024
AT5G47460.1 pentatricopeptide (PPR) repeat-containing protein2703e-024
AT4G33170.1 pentatricopeptide (PPR) repeat-containing protein2651e-023
AT3G24000.1 INVOLVED IN: biological_process unknown; EXPRESSED IN: shoot apex, carpel; EXPRESSED DURING: petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT3G23330.1); Has 15874 Blast hits to 5333 proteins in 187 species: Archae - 1; Bacteria - 6; Metazoa - 100; Fungi - 81; Plants - 15349; Viruses - 0; Other Eukaryotes - 337 (source: NCBI BLink).2551e-022

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  100%

Unigene Members