Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN57585

FASTA Sequence
Unigene ID: UN57585Length: 205 SSR 
AACCCCAAATTGAAACATTAATATATATAAAAATAGCAAATATTCCAAACTTAATAAAATTAAACACAAAAAAATTAAAGTTGCAA
AACATATATATATATAACATGCTGCATAAAAAACATATATCTGGGAAAGTAAAATCTGGTCGGAAACCCTACAAAAAAAAAGGATG
GAAAAAACAAACATATATAAAAATACCCAAAAA

Annotation (GO term)
GenBank top hits Scoree value
No hits found  

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits Scoree value
No hits found  

Arabidopsis top hits Scoree value
No hits found  

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  100%

Unigene Members