RadishBase

| | | |

Information for unigene UN57845

FASTA Sequence

Unigene ID: UN57845	Length: 308	SSR
GGGGGTTCGCCACGAGAGTTACCGTCGTCGTTTCAAGTTTAGGGTTTTAGGTATCACAAAACTTCTCTCTCTCTCTTCTCATTTTC GATTTCCTAATTGAATCAAATTTATGAACCCACCCTCTCCATCCTTTACTAGAGGATTACATGGTCCAAACCTTAAACGATAGATG TACTCAAGATGATGTTACAAGTGAGGAGAATCTCTCTGATGAAGACGAGTCCAAGTTGCCGTTGCAGTTAGCTATTGTGGGTAGAC CTAACGTTGGGAAATCAACATTGCTAAATGCATTGCTGGAAGAAGAGCGT

Annotation (GO term)

GenBank top hits (Blast detail)	Score	e value
XP_002868685 GTP-binding family protein [Arabidopsis lyrata subsp. lyrata]	255	1e-020
NP_198812 GTP-binding protein [Arabidopsis thaliana]	240	6e-019
BAB10220 GTP-binding protein-like [Arabidopsis thaliana]	226	2e-017
XP_002328739 predicted protein [Populus trichocarpa]	204	9e-015
EAY73092 hypothetical protein OsI_00968 [Oryza sativa Indica Group]	198	4e-014

Swiss-Prot top hits (Blast detail)	Score	e value
Q5QYB3 GTP-binding protein engA	139	1e-008
Q7N702 GTP-binding protein engA	124	6e-007
Q89MZ0 GTP-binding protein engA	123	8e-007
Q2IXA7 GTP-binding protein engA	123	8e-007
A4YUE1 GTP-binding protein engA	122	1e-006

TrEMBL top hits (Blast detail)	Score	e value
Q9FLE0 GTP-binding protein-like	226	2e-017
B9N0K0 Predicted protein	204	6e-015
A2WM96 Putative uncharacterized protein	198	3e-014
B9EU67 Putative uncharacterized protein	198	3e-014
C5XKB1 Putative uncharacterized protein Sb03g001220	185	1e-012

Arabidopsis top hits (Blast detail)	Score	e value
AT5G39960.1 GTP-binding family protein	240	2e-021
AT3G12080.1 emb2738 (embryo defective 2738); GTP binding	109	2e-006
AT3G12080.2 emb2738 (embryo defective 2738); GTP binding	109	2e-006

EST library breakdown for ESTs in the assembly

Library

ESTs

Percentage of ESTs in assembly


7	1			100%

Unigene Members