|
Information for unigene UN58905
FASTA Sequence |
Unigene ID: UN58905 | Length: 310 |
SSR | | TCTTCTCACCGTTCGTCTTCTGATCAGATCAGATCAGATCAGATCATATCAGCCATGGAGGATGAGATTGAGTTGAAAACTGCCCC
TGCTGATTTCCGGTTCCCTACAACGAACCAGACAAGGCACTGTTTCACCCGCTACATTGAGTTCCACAGGTGTACAACTGCAAAGG
GAGAGGACTCCAATGAATGCGAGAGGTCGCCAAGTACTACCGCGCTCTCTGCCTGGAGAATGGGTGACAAGTGGAATGAGCAGAGG
GAGACGGAACTTTCCCTGTCTCTCTGATTGAGCAGATCAGGTCTCTTTATCA
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002867470 hypothetical protein ARALYDRAFT_913717 [Arabidopsis lyrata subsp. lyrata] | 303 | 3e-026 |
NP_194535 cytochrome c oxidase, subunit 6b [Arabidopsis thaliana] | 300 | 6e-026 |
NP_568867 cytochrome c oxidase subunit VIb [Arabidopsis thaliana] | 292 | 5e-025 |
AAM64280 cytochrome c oxidase subunit 6b [Arabidopsis thaliana] | 288 | 2e-024 |
XP_002864529 hypothetical protein ARALYDRAFT_918963 [Arabidopsis lyrata subsp. lyrata] | 284 | 5e-024 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O94581 Cytochrome c oxidase subunit 6B | 141 | 6e-009 |
Q01519 Cytochrome c oxidase subunit 6B | 137 | 2e-008 |
P14854 Cytochrome c oxidase subunit 6B1 | 137 | 2e-008 |
Q5RCT0 Cytochrome c oxidase subunit 6B1 | 135 | 3e-008 |
Q7YRK6 Cytochrome c oxidase subunit 6B1 | 130 | 1e-007 |
TrEMBL top hits (Blast detail) | Score | e value |
Q945L0 AT4g28060/T13J8_170 | 292 | 4e-025 |
Q8LD51 Cytochrome c oxidase subunit 6b | 288 | 1e-024 |
B9SQE4 Cytochrome C oxidase polypeptide vib, putative | 256 | 6e-021 |
Q8LCP1 Cytochrome c oxidase subunit, putative | 252 | 2e-020 |
Q9S7L9 Putative cytochrome c oxidase subunit | 252 | 2e-020 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT5G57815.1 cytochrome c oxidase subunit 6b, putative | 292 | 1e-027 |
AT4G28060.1 cytochrome c oxidase subunit 6b, putative | 264 | 3e-024 |
AT1G22450.1 COX6B (CYTOCHROME C OXIDASE 6B); cytochrome-c oxidase | 252 | 6e-023 |
AT1G32710.1 cytochrome c oxidase subunit VIb family | 126 | 3e-008 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
|
|
|