Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN58905

FASTA Sequence
Unigene ID: UN58905Length: 310 SSR 
TCTTCTCACCGTTCGTCTTCTGATCAGATCAGATCAGATCAGATCATATCAGCCATGGAGGATGAGATTGAGTTGAAAACTGCCCC
TGCTGATTTCCGGTTCCCTACAACGAACCAGACAAGGCACTGTTTCACCCGCTACATTGAGTTCCACAGGTGTACAACTGCAAAGG
GAGAGGACTCCAATGAATGCGAGAGGTCGCCAAGTACTACCGCGCTCTCTGCCTGGAGAATGGGTGACAAGTGGAATGAGCAGAGG
GAGACGGAACTTTCCCTGTCTCTCTGATTGAGCAGATCAGGTCTCTTTATCA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002867470 hypothetical protein ARALYDRAFT_913717 [Arabidopsis lyrata subsp. lyrata]3033e-026
NP_194535 cytochrome c oxidase, subunit 6b [Arabidopsis thaliana]3006e-026
NP_568867 cytochrome c oxidase subunit VIb [Arabidopsis thaliana]2925e-025
AAM64280 cytochrome c oxidase subunit 6b [Arabidopsis thaliana]2882e-024
XP_002864529 hypothetical protein ARALYDRAFT_918963 [Arabidopsis lyrata subsp. lyrata]2845e-024

Swiss-Prot top hits (Blast detail)Scoree value
O94581 Cytochrome c oxidase subunit 6B1416e-009
Q01519 Cytochrome c oxidase subunit 6B1372e-008
P14854 Cytochrome c oxidase subunit 6B11372e-008
Q5RCT0 Cytochrome c oxidase subunit 6B11353e-008
Q7YRK6 Cytochrome c oxidase subunit 6B11301e-007

TrEMBL top hits (Blast detail)Scoree value
Q945L0 AT4g28060/T13J8_1702924e-025
Q8LD51 Cytochrome c oxidase subunit 6b2881e-024
B9SQE4 Cytochrome C oxidase polypeptide vib, putative2566e-021
Q8LCP1 Cytochrome c oxidase subunit, putative2522e-020
Q9S7L9 Putative cytochrome c oxidase subunit2522e-020

Arabidopsis top hits (Blast detail)Scoree value
AT5G57815.1 cytochrome c oxidase subunit 6b, putative2921e-027
AT4G28060.1 cytochrome c oxidase subunit 6b, putative2643e-024
AT1G22450.1 COX6B (CYTOCHROME C OXIDASE 6B); cytochrome-c oxidase2526e-023
AT1G32710.1 cytochrome c oxidase subunit VIb family1263e-008

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  100%

Unigene Members