|
Information for unigene UN58992
FASTA Sequence |
Unigene ID: UN58992 | Length: 445 |
SSR | | TTTCGTTCGTCGTCGTACATCTCTCTCTCTCTCTCTCTCTCTAGCTCTCCTCGCTCATCTAGGGTTGAAAATGGCAGGACACAAGG
TTGTGCATGCCACACTTAAAGGCCCGAGTGTAGTGAAGGAATTAGTTATCGGTCTGGCGCTGGGTTTAGCTTCTGGTGGTCTCTGG
AAGATGCACCACTGGAACGAGCAGAGGAAAACCAGAGCTTTCTATGACTTGCTCGAGAGAGGCGAGATCAGCGTTGTCCACCCTGA
AGAGTGAAATTCAACACTATGCCAAACCATTCTCTCAAGCTCTATTTTTATGTTATTATTATTGTTTCTTGACTTCTTAGACAAAA
GTTAAGAAAGTGTTGATTGCAGAAGAAATAAACAACAAATCGGATATCTTTTGTTAAATTTCAGAACATCCTTCTTGATTTTATTT
GAATGTTTTTGGCAT
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata] | 309 | 5e-027 |
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata] | 307 | 8e-027 |
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana] | 304 | 2e-026 |
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata] | 304 | 2e-026 |
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-2 | 300 | 5e-026 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O22912 Probable cytochrome c oxidase subunit 5C-1 | 304 | 1e-027 |
Q9LZQ0 Cytochrome c oxidase subunit 5C-2 | 300 | 4e-027 |
Q9FLK2 Probable cytochrome c oxidase subunit 5C-3 | 299 | 5e-027 |
Q8VY39 Cytochrome c oxidase subunit 5C-2 | 273 | 5e-024 |
Q9SXX7 Cytochrome c oxidase subunit 5C | 267 | 2e-023 |
TrEMBL top hits (Blast detail) | Score | e value |
Q2HIR0 At5g61310 | 299 | 5e-026 |
A1YMW4 Cytochrome-c oxidase | 293 | 2e-025 |
D6BR49 Cytochrome c oxidase polypeptide Vc | 279 | 1e-023 |
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative | 277 | 2e-023 |
C6T2P2 Putative uncharacterized protein | 268 | 2e-022 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein | 305 | 1e-028 |
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 300 | 4e-028 |
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 300 | 4e-028 |
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 300 | 4e-028 |
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative | 300 | 4e-028 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
|
|
|