Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN58992

FASTA Sequence
Unigene ID: UN58992Length: 445 SSR 
TTTCGTTCGTCGTCGTACATCTCTCTCTCTCTCTCTCTCTCTAGCTCTCCTCGCTCATCTAGGGTTGAAAATGGCAGGACACAAGG
TTGTGCATGCCACACTTAAAGGCCCGAGTGTAGTGAAGGAATTAGTTATCGGTCTGGCGCTGGGTTTAGCTTCTGGTGGTCTCTGG
AAGATGCACCACTGGAACGAGCAGAGGAAAACCAGAGCTTTCTATGACTTGCTCGAGAGAGGCGAGATCAGCGTTGTCCACCCTGA
AGAGTGAAATTCAACACTATGCCAAACCATTCTCTCAAGCTCTATTTTTATGTTATTATTATTGTTTCTTGACTTCTTAGACAAAA
GTTAAGAAAGTGTTGATTGCAGAAGAAATAAACAACAAATCGGATATCTTTTGTTAAATTTCAGAACATCCTTCTTGATTTTATTT
GAATGTTTTTGGCAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880298 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3095e-027
XP_002866426 hypothetical protein ARALYDRAFT_496289 [Arabidopsis lyrata subsp. lyrata]3078e-027
NP_182260 putative cytochrome c oxidase subunit 5C-1 [Arabidopsis thaliana]3042e-026
XP_002862722 cytochrome c oxidase subunit VC family protein [Arabidopsis lyrata subsp. lyrata]3042e-026
Q9LZQ0 RecName: Full=Cytochrome c oxidase subunit 5C-2; AltName: Full=Cytochrome c oxidase polypeptide Vc-23005e-026

Swiss-Prot top hits (Blast detail)Scoree value
O22912 Probable cytochrome c oxidase subunit 5C-13041e-027
Q9LZQ0 Cytochrome c oxidase subunit 5C-23004e-027
Q9FLK2 Probable cytochrome c oxidase subunit 5C-32995e-027
Q8VY39 Cytochrome c oxidase subunit 5C-22735e-024
Q9SXX7 Cytochrome c oxidase subunit 5C2672e-023

TrEMBL top hits (Blast detail)Scoree value
Q2HIR0 At5g613102995e-026
A1YMW4 Cytochrome-c oxidase2932e-025
D6BR49 Cytochrome c oxidase polypeptide Vc2791e-023
B9RNE3 Cytochrome c oxidase polypeptide Vc, putative2772e-023
C6T2P2 Putative uncharacterized protein2682e-022

Arabidopsis top hits (Blast detail)Scoree value
AT2G47380.1 cytochrome c oxidase subunit Vc family protein / COX5C family protein3051e-028
AT5G61310.1 cytochrome c oxidase subunit Vc, putative / COX5C, putative3004e-028
AT5G61310.2 cytochrome c oxidase subunit Vc, putative / COX5C, putative3004e-028
AT5G61310.3 cytochrome c oxidase subunit Vc, putative / COX5C, putative3004e-028
AT5G61310.4 cytochrome c oxidase subunit Vc, putative / COX5C, putative3004e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
81  100%

Unigene Members