 |
Information for unigene UN59649
| FASTA Sequence |
| Unigene ID: UN59649 | Length: 693 |
SSR | | CTATCAAAACTGGAAACCCAACAAAACAAACATACAAGATGACTTCGTCACCAAAACTCCTCTCTTTACTTCTCTTGTACGTCTTC
ATTTCATTAGCCTCCGGTCATGAGTCCATCATCAATGACAACCATCTCAATCTTCCATCTGACGGCTCGTGGAGAACTGATGAAGA
AGTGAAGTCCATCTACTTACAATGGTCCGCGGAGCACGGGAAAACTAACAACAACAACAACAACGGTATCATCAACCAACAAGATG
AAAGATTCAATATTTTCAAAGACAACCTAAGATTCATCGATTTGCACAACGAGAACAACAAGAACGCCACTTACAAGCTCGGTCTC
ACCATATTCGCTGATCTCACTAACGATGAGTACCGGAGATTATGCTTTTCAATTCATTATGAAAAACGGTGGATTAAACACCGAGC
AAGATTATCCTTACCGTGGATCCGATGGCAAATGCAACTCTTTACTGAAGAATTCGAAAGTTGTAACTATCGATGGATACGAAGAT
GTTCCTAGTAACGATGAAACCGCGTTGAAGAGAGCAGTTTCATACCAGCCTGTGAGTGTTGCTATTGACGCTGGTGGAAGAGTTTT
CCAACACTACCAATCTGGAATCTTCACTGGAGAGTGTGGTACAGAATGGATCACGCTGTGGTGGCGGTGGGTTATGGATCAGAGAA
CGGCG
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| P25251 RecName: Full=Cysteine proteinase COT44; Flags: Precursor | 434 | 6e-041 |
| AAB23155 COT44=cysteine proteinase homolog [Brassica napus, seedling, rapid cycling base population CrGC5, Peptide, 328 aa] | 434 | 6e-041 |
| Q94B08 RecName: Full=Germination-specific cysteine protease 1; Flags: Precursor | 417 | 6e-039 |
| NP_195406 cysteine proteinase1 [Arabidopsis thaliana] | 417 | 6e-039 |
| BAF00916 cysteine proteinase [Arabidopsis thaliana] | 412 | 2e-038 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q94B08 Germination-specific cysteine protease 1 | 491 | 7e-049 |
| P25251 Cysteine proteinase COT44 (Fragment) | 434 | 3e-042 |
| P43297 Cysteine proteinase RD21a | 334 | 1e-030 |
| P20721 Low-temperature-induced cysteine proteinase (Fragment) | 333 | 1e-030 |
| Q7XR52 Cysteine protease 1 | 324 | 2e-029 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| Q0WPN3 Cysteine proteinase | 412 | 1e-038 |
| C4TPG0 Cysteine protease (Fragment) | 364 | 5e-033 |
| Q6QT16 Cysteine protease-like protein (Fragment) | 361 | 1e-032 |
| Q6F6A9 Cysteine protease | 357 | 4e-032 |
| Q84M29 Cysteine protease-1 | 351 | 2e-031 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT4G36880.1 CP1 (CYSTEINE PROTEINASE1); cysteine-type endopeptidase/ cysteine-type peptidase | 496 | 2e-050 |
| AT5G43060.1 cysteine proteinase, putative / thiol protease, putative | 335 | 8e-032 |
| AT1G47128.1 RD21 (responsive to dehydration 21); cysteine-type endopeptidase/ cysteine-type peptidase | 334 | 1e-031 |
| AT3G19390.1 cysteine proteinase, putative / thiol protease, putative | 320 | 4e-030 |
| AT3G48340.1 cysteine-type endopeptidase/ cysteine-type peptidase | 303 | 4e-028 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
