Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN59834

FASTA Sequence
Unigene ID: UN59834Length: 282 SSR 
GCAACGAAGACGTTCAGCTTCTTCCCTCTTTTGTATACAGCAGCGATGAGAAAAAACCAGAGGAAGAAAACAATAATAGTTGTGGA
GAGAACACTTCTCCTTCTCCTTCTCCTGAGATCCAAGTAGAAGTCACTGTACACGAAGATTTCTCCACGTGGCAACGTATCATCCG
TCTTGATGCATTACGTGCTGACTCCGACTGGGCTACATACTCTTCTTCTTCTTCTTCCACCGCAATCACAGAAACCAAAGCTCGCT
GTTTAGCTGAGTCCGTAGGTTTAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002865979 hypothetical protein ARALYDRAFT_495433 [Arabidopsis lyrata subsp. lyrata]3275e-029
BAB09733 GTPase activator protein of Rab-like small GTPases-like protein [Arabidopsis thaliana]2811e-023
NP_200169 RabGAP/TBC domain-containing protein [Arabidopsis thaliana]2811e-023
NP_001154777 RabGAP/TBC domain-containing protein [Arabidopsis thaliana]2811e-023
BAD94281 GTPase activator protein of Rab-like small GTPases-like protein [Arabidopsis thaliana]2693e-022

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q94BY9 AT5g53570/MNC6_112817e-024
Q9FJC7 GTPase activator protein of Rab-like small GTPases-like protein2817e-024
Q56WX5 GTPase activator protein of Rab-like small GTPases-like protein (Fragment)2692e-022
B9RYT6 Putative uncharacterized protein1572e-009
B9GY30 Predicted protein1562e-009

Arabidopsis top hits (Blast detail)Scoree value
AT5G53570.1 RabGAP/TBC domain-containing protein2922e-027
AT5G53570.2 RabGAP/TBC domain-containing protein2922e-027
AT5G24390.1 RabGAP/TBC domain-containing protein1504e-011
AT5G41940.1 RabGAP/TBC domain-containing protein1461e-010
AT3G49350.1 RAB GTPase activator1381e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  100%

Unigene Members