Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN60019

FASTA Sequence
Unigene ID: UN60019Length: 301 SSR 
CTGAAACAAACGGGAAACATTTGCAAATTGTATTCTATCAATGTTAACGAAGTTTGGTTATACAACTGGGAACATAAACCCCAATG
CCAAGGGAAATTTGAAAAATAAAATGCTTGAAACAAAATGAAATGCTTGAAACAAGCAATGACAAAGTTGAACAAACAAAACTACA
GAGAGAGAGAGTTCATAAAGAGATCTTCAAAAAAGGGATTTGTCAGGTAAATCATCGAAGTAAGGATGCTCCATACCCTTCTTAGC
TGAAATTCGTTTAACTGGCTCATACTCCAGCATTTTCAATAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_173517 cyclin-dependent kinase B2-2 [Arabidopsis thaliana]1483e-008
AAM61014 putative cell division control protein cdc2 kinase [Arabidopsis thaliana]1483e-008
XP_002893139 cyclin-dependent kinase B2_2 [Arabidopsis lyrata subsp. lyrata]1483e-008
NP_177780 cyclin-dependent kinase B2-1 [Arabidopsis thaliana]1359e-007
AAK63856 At1g76540/F14G6_14 [Arabidopsis thaliana]1359e-007

Swiss-Prot top hits (Blast detail)Scoree value
Q8LG64 Cyclin-dependent kinase B2-21481e-009
Q8LF80 Cyclin-dependent kinase B2-11353e-008

TrEMBL top hits (Blast detail)Scoree value
A3FKF4 Cyclin-dependent kinase1275e-006

Arabidopsis top hits (Blast detail)Scoree value
AT1G20930.1 CDKB2;2 (CYCLIN-DEPENDENT KINASE B2;2); cyclin-dependent protein kinase/ kinase1487e-011
AT1G76540.1 CDKB2;1 (cyclin-dependent kinase B2;1); cyclin-dependent protein kinase/ kinase/ protein binding1352e-009
AT3G54180.1 CDKB1;1 (CYCLIN-DEPENDENT KINASE B1;1); cyclin-dependent protein kinase/ kinase/ protein binding1049e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  100%

Unigene Members