Information for unigene UN61843
| FASTA Sequence |
| Unigene ID: UN61843 | Length: 133 |
SSR | | ACCACAGAGAGGCATCTTTAATAGAAGGAAACGAGAGAAGTTCTCTGTATTCAGAGAGAGAGAGAGAGAGAGAGAGAGAAAGATGG
GTGTTTTAAAGGAAGCTCACAACGTGAAAGTGATCGGCACAGGAACT
|
|
|
| GenBank top hits | Score | e value |
| No hits found | | |
| Swiss-Prot top hits | Score | e value |
| No hits found | | |
| TrEMBL top hits | Score | e value |
| No hits found | | |
| Arabidopsis top hits | Score | e value |
| No hits found | | |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|