Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN62155

FASTA Sequence
Unigene ID: UN62155Length: 283 SSR 
GGTGGTCCAGGTTCCTTGCCTGCCACTGGTCCCGGCCCTTTACCAGTTGCTGGTTCAGCCACCGGTCCTGGAGTAAGCACCGGCCA
AGCTCTTGGTGGTGGTGCAGGGGCTGGTCCATCTCTTGGTGGTGGTGCAGGTGCTGGTCCAGCTCTTGGTGGTGGTGGTGGTGGTG
TAGGTCCTGACCACACATTAGTGTTCTTTATGCACGACATACTAGGCGGTTCAAATCCCACGGCAAGAGCCGTAACGGAGTCGTCG
CAAACCCGGCTTTAAGTGGTCAACT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002881003 hypothetical protein ARALYDRAFT_481780 [Arabidopsis lyrata subsp. lyrata]2981e-025
NP_180435 Disease resistance-responsive (dirigent-like protein) family protein [Arabidopsis thaliana]2479e-020
NP_001118404 uncharacterized protein [Arabidopsis thaliana]2433e-019
XP_002039125 GM17356 [Drosophila sechellia]1537e-009
XP_002562157 Pc18g03170 [Penicillium chrysogenum Wisconsin 54-1255]1511e-008

Swiss-Prot top hits (Blast detail)Scoree value
P40602 Anter-specific proline-rich protein APG1335e-008
P09789 Glycine-rich cell wall structural protein 11282e-007
Q9T0K5 Leucine-rich repeat extensin-like protein 31282e-007
Q9LUI1 Leucine-rich repeat extensin-like protein 61282e-007
Q8N7U7 Tetra-peptide repeat homeobox protein 11282e-007

TrEMBL top hits (Blast detail)Scoree value
Q9SIA8 At2g286702476e-020
B3H4H9 Uncharacterized protein At2g28671.12432e-019
B4I5W5 DNA topoisomerase1535e-009
B6HB85 Pc18g03170 protein1519e-009
A5G4L0 Putative outer membrane adhesin like protein1473e-008

Arabidopsis top hits (Blast detail)Scoree value
AT2G28670.1 disease resistance-responsive family protein / fibroin-related2473e-022
AT2G28671.1 unknown protein2437e-022
AT1G07730.2 disease resistance-responsive family protein2302e-020
AT1G20130.1 hydrolase, acting on ester bonds / lipase/ structural constituent of cell wall1334e-009
AT1G59910.1 formin homology 2 domain-containing protein / FH2 domain-containing protein1317e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members