Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN62781

FASTA Sequence
Unigene ID: UN62781Length: 755 SSR 
GGTTCAGCCATTGATTTTAGTATTACATCTGGGTTTTGGATTGGTGGTGCTGTTAGAAACAAGTATTGATTCTTTTTATGCCCTTA
GGAAGGAGTTATAAGATGGAGGAACTTGGCGAAATTTTAAAGAACAACAGGACGAAAGATATCTCTTGGCTTTGCTCTCTCTCAGA
ACCTGAGCTGGTTAAAAATATATCTATACTTGTTATTTATTTATTTATTTATTTTGAGACCAGTCAGCGATTGTTATTATTACCAA
TCCATATTCGTGTTTTTGCAGGATTTGCTCATCAGCTTAAAGAAGCTAGCCATTCATCGAGCTGAGATAACTGATCACGACGAACT
AGCTGATCATTTTAATCTCAAGCTGCTCCGAGCTCTCGGTATGTCTTTGTATTTTGGCTTCTCTCAGATTCTGAAAATCTAGTGGT
AGTGGAGCAGCTTTCCATATTTTACAAGTAAGACTGGGTACTCTTGCAGGGCTTGTGGCAATGGAATATGTAAGAAAAGCGGATAC
TTCACTTGTCCCAAGTGCTGGTCATCAACTCAAGGGTTTGGATCAATGCGATCTGTTGAAAACTCATGTCGATGATACAGCAATAG
ACATAGAGGAGATTGTGAGTGGAATCTGCAACATGAAAAAGAAAAAGAAGAAGAAGAGAAAACCCATCAGATTAAAAAATAAATCT
CGCAAAAGGTTGGTTGGTTGGGGGATATATTCTGATCACAATCACTACTTGGATCTACTTCTTCTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAD55478 Hypothetical protein [Arabidopsis thaliana]1847e-012
NP_680548 uncharacterized protein [Arabidopsis thaliana]1847e-012
NP_565234 Spc97 / Spc98 family of spindle pole body (SBP) component [Arabidopsis thaliana]1812e-011
AAM61485 unknown [Arabidopsis thaliana]1812e-011
XP_002889303 hypothetical protein ARALYDRAFT_316935 [Arabidopsis lyrata subsp. lyrata]1802e-011

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q58FV2 Putative uncharacterized protein1845e-012
Q9SSB6 F18B13.31 protein (Fragment)1845e-012
Q0V7R8 At1g802451811e-011
Q8LFC7 Putative uncharacterized protein1811e-011
Q56YF7 Putative uncharacterized protein1782e-011

Arabidopsis top hits (Blast detail)Scoree value
AT4G00695.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80245.3); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1843e-014
AT4G00695.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: cotyledon; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G80245.3); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1843e-014
AT1G80245.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00695.2); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1817e-014
AT1G80245.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00695.2); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1817e-014
AT1G80245.3 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: microtubule cytoskeleton organization; LOCATED IN: spindle pole, microtubule organizing center; EXPRESSED IN: 20 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Spc97/Spc98 (InterPro:IPR007259); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G00695.2); Has 17 Blast hits to 17 proteins in 4 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 17; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).1817e-014

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  100%

Unigene Members