Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN63341

FASTA Sequence
Unigene ID: UN63341Length: 305 SSR 
GGGAATCGTCTCGTCGTCCTCACAGTTTCATCGGCCGTTGACTATCTCCGGCGACAAGAGAGAGAGAGATCAGAATCGTATCGGTT
TCTAATTTCTTTCTCGTTCAAGCTTTATTAAAAAATGGCTGAAGCTGATGATATTCAACCCATCGTCTGTGACAATGGTACCGGTA
TGGTCAAGGCTGGATTTGCTGGTGATGATGCTCCAAGGGCTGTGTTCCCTAGCGTTGTTGGTAGGCCAAGACATCACGGTGTCATG
GTTGGGATGAACCAGAAGGATGCTTACTTGGTGACGAAGCTCATCCA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_188508 actin 2 [Arabidopsis thaliana]2962e-025
NP_850611 actin 2 [Arabidopsis thaliana]2962e-025
BAH20120 AT3G18780 [Arabidopsis thaliana]2962e-025
ACR78201 actin 1 [Brassica rapa subsp. pekinensis]2962e-025
NP_175350 actin 8 [Arabidopsis thaliana]2934e-025

Swiss-Prot top hits (Blast detail)Scoree value
Q96292 Actin-22967e-027
Q96293 Actin-82931e-026
P46258 Actin-32733e-024
A2XLF2 Actin-12707e-024
Q10DV7 Actin-12707e-024

TrEMBL top hits (Blast detail)Scoree value
B9DHA3 AT3G18780 protein2961e-025
C5IWW9 Actin 1 (Fragment)2961e-025
Q0WL95 AT3G18780 protein2961e-025
Q8LB94 Actin 82933e-025
Q9ZTP9 Actin2881e-024

Arabidopsis top hits (Blast detail)Scoree value
AT3G18780.1 ACT2 (ACTIN 2); structural constituent of cytoskeleton2965e-028
AT3G18780.2 ACT2 (ACTIN 2); structural constituent of cytoskeleton2965e-028
AT1G49240.1 ACT8 (ACTIN 8); copper ion binding / structural constituent of cytoskeleton2931e-027
AT2G37620.1 ACT1 (ACTIN 1); structural constituent of cytoskeleton2662e-024
AT2G37620.2 ACT1 (ACTIN 1); structural constituent of cytoskeleton2662e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  100%

Unigene Members