Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN63593

FASTA Sequence
Unigene ID: UN63593Length: 622 SSR 
ATACGATACAAAACATGCTATAAAATCTACAAAACGTAATAAAAAGTGATTAGGTTTCATAAGAGAGACCTCGTGAGAAACAACTT
AAACAATGAAATGAAACAGAGAGAACAAAGAAGACAAATCCACTTCCAAAACTCTAGTCTGTCAAAAACCAGAGAGTAAAAATAAC
TACCTCTACAAAGTGAGAGTGCGTCTGTATAAAACTTCATCATCATCACTCTCATCATCATCATCATCTTCATCAGACACAACCTC
ACCACCACCACCACAACCAGGCATCTCCAACCTCCCACCCATATCAAACACCGGCCCCCCTTCAGCAGTATCCGCATCGATAAAGT
TACCTTCCAACCGCTCCTCAAACCTCTGGTCACTACAGTTCAAGAACCAGTTCAACGAACTCCTAATCCCTTTCCCCTGCAGCTTC
TGGTACCTAGGCTTAATCCTCGACTCCAACCCATAAGTAAAATACTCAGGATACTCCACCAACTCCTTCATCGGCCTCCCCATCTC
CGTCTTGTAAAAGTAGTAACTATTCTTCATCAGCTCAACCCTCGAGCAAAGTATCTGAGGACACCTCACAACCATCCTCGCAACGT
CCTCAACCTTAAACGCTCTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002881945 hypothetical protein ARALYDRAFT_903808 [Arabidopsis lyrata subsp. lyrata]5913e-059
NP_566005 transcription termination factor domain-containing protein [Arabidopsis thaliana]5878e-059
XP_002327325 predicted protein [Populus trichocarpa]5001e-048
XP_002279655 PREDICTED: hypothetical protein [Vitis vinifera]4685e-045
XP_002534290 conserved hypothetical protein [Ricinus communis]4677e-045

Swiss-Prot top hits (Blast detail)Scoree value
Q5VYV0 Forkhead box protein B21502e-009
Q8MP30 Uncharacterized histidine-rich protein DDB_G02745571412e-008
P04929 Histidine-rich glycoprotein1368e-008
Q1A1A3 Forkhead box protein G11287e-007
Q1A1A4 Forkhead box protein G11206e-006

TrEMBL top hits (Blast detail)Scoree value
O80572 Expressed protein5876e-059
B9MW46 Predicted protein5007e-049
B9T7S1 Putative uncharacterized protein4675e-045
C5XTQ2 Putative uncharacterized protein Sb04g0352104569e-044
B9F3L5 Putative uncharacterized protein4523e-043

Arabidopsis top hits (Blast detail)Scoree value
AT2G44020.1 mitochondrial transcription termination factor-related / mTERF-related5874e-061
AT4G02990.1 mitochondrial transcription termination factor family protein / mTERF family protein3008e-028
AT1G78930.1 mitochondrial transcription termination factor-related / mTERF-related1466e-010
AT2G36000.2 mitochondrial transcription termination factor-related / mTERF-related1457e-010
AT2G03050.1 mitochondrial transcription termination factor-related / mTERF-related1431e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members