Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN63611

FASTA Sequence
Unigene ID: UN63611Length: 255 SSR 
AAAAATACCCAAACACATAACAAAATAAAAATAGATTTACTTTTGTAAGTTTGTTGGAAAAAAACATAAAAATAAAAAAAAAAATC
AAACTTTTGTCACATACCCCCACACACACACAATGTTGATGGGGTCTGTTTCAGTTGTACTTCCCCTTCTTGATCTTGAAGGAAAA
AAATCGGATAACGTCCTCATCGGCAGTGAGAGCTGTCTCGAGGGGAGTGATGGATTCAGGTTTGGGGAAGTAAGTGAAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002886339 ribosomal protein S6 family protein [Arabidopsis lyrata subsp. lyrata]1546e-009
AAF19690 F1N19.8 [Arabidopsis thaliana]1492e-008
NP_176632 30S ribosomal protein S6 alpha [Arabidopsis thaliana]1492e-008
P82403 RecName: Full=30S ribosomal protein S6 alpha, chloroplastic; Contains: RecName: Full=30S ribosomal protein S6 beta, chloroplastic; Contains: RecName: Full=30S ribosomal protein S6 gamma, chloroplastic; Contains: RecName: Full=30S ribosomal protein S6 delta, chloroplastic; Contains: RecName: Full=30S ribosomal protein S6 epsilon, chloroplastic; Flags: Precursor1322e-006

Swiss-Prot top hits (Blast detail)Scoree value
Q8VY91 30S ribosomal protein S6 alpha, chloroplastic1498e-010
P82403 30S ribosomal protein S6 alpha, chloroplastic (Fragment)1327e-008

TrEMBL top hits Scoree value
No hits found  

Arabidopsis top hits (Blast detail)Scoree value
AT1G64510.1 ribosomal protein S6 family protein1505e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members