Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN63735

FASTA Sequence
Unigene ID: UN63735Length: 333 SSR 
AAGTTCTGAATCTTCTGATTAGCTTAAACTGATCAAGAACTATTCACGAGATGGAAAAGACTTAAAATGCATTAATAAATAGATTT
TCCTTCAAATTCAGTGCTCTGCTTCACCATTTTCTTCAATCTTTTTCTTCTTCTTCTTCTTCTCCTCTTCCTCCTTTGCCTCCTTC
TCTGCTTTCTTTTCCTTTCTCCTCTTCTTCTCTTCCTCTTCTTCCTTCTTCTGCTTCACTTCTTCCTCATCTCTCCTCTTTGCCTC
CTCCTTTTCCTCTTTCAAAGCTTCAATCAAACGCCTCAAACAAGTCTCTGCCTCTTCCCCTTCTGACTTAGGCAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_198817 AAA-ATPase 1 [Arabidopsis thaliana]2074e-015
NP_189492 AAA-type ATPase family protein [Arabidopsis thaliana]1886e-013
XP_446954 hypothetical protein [Candida glabrata CBS 138]1797e-012
XP_002633098 Hypothetical protein CBG05788 [Caenorhabditis briggsae]1789e-012
NP_189499 AAA-type ATPase family protein [Arabidopsis thaliana]1743e-011

Swiss-Prot top hits (Blast detail)Scoree value
P36044 Protein MNN41542e-010
P54696 Myosin-H heavy chain1514e-010
Q9EPQ2 X-linked retinitis pigmentosa GTPase regulator-interacting protein 11505e-010
A5E4P1 Protein PXR11471e-009
A5DAC8 ATP-dependent RNA helicase DBP31452e-009

TrEMBL top hits (Blast detail)Scoree value
Q9FLD5 Similarity to AAA-type ATPase2073e-015
Q9LH84 Putative uncharacterized protein At3g285101884e-013
Q6FS40 Similar to uniprot|P33322 Saccharomyces cerevisiae YLR175w CBF51795e-012
Q9LJJ7 Mitochondrial protein-like1742e-011
A8N8W7 Putative uncharacterized protein1671e-010

Arabidopsis top hits (Blast detail)Scoree value
AT5G40010.1 AATP1 (AAA-ATPase 1); ATP binding / ATPase/ nucleoside-triphosphatase/ nucleotide binding2071e-017
AT3G28510.1 AAA-type ATPase family protein1882e-015
AT3G28580.1 AAA-type ATPase family protein1792e-014
AT2G18540.1 cupin family protein1541e-011
AT3G28540.2 AAA-type ATPase family protein1461e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members