Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN64451

FASTA Sequence
Unigene ID: UN64451Length: 165 SSR 
GAACGAACGGTCTCAAAGCTCGCGTCTTTGGGTTACGGCCATGACGTGGCGCTGAGAGCTGTGCTGAGCAACGGGTACTGTTACGG
CGGGATGGATGTTCTGACCAACATTCTCCACAACGCGTTGGCTTGTCTGAAAGGTGATGGTGGTGGTGGTGGTGTGATG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_181076 RING-finger domain-containing protein [Arabidopsis thaliana]1871e-012
AAC36187 unknown protein [Arabidopsis thaliana]1871e-012
NP_001189683 RING-finger domain-containing protein [Arabidopsis thaliana]1871e-012
CAN78110 hypothetical protein VITISV_004428 [Vitis vinifera]1833e-012
XP_002281049 PREDICTED: hypothetical protein [Vitis vinifera]1833e-012

Swiss-Prot top hits (Blast detail)Scoree value
Q8RX22 MND1-interacting protein 11703e-012

TrEMBL top hits (Blast detail)Scoree value
O82304 Putative uncharacterized protein At2g353301877e-013
Q8L7B1 Putative uncharacterized protein At2g353301877e-013
A5ANR3 Putative uncharacterized protein1832e-012
B9MU03 Predicted protein1771e-011
B9N2P5 Predicted protein1733e-011

Arabidopsis top hits (Blast detail)Scoree value
AT2G35330.1 protein binding / zinc ion binding1873e-015
AT1G32530.1 zinc finger (C3HC4-type RING finger) family protein1702e-013

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members