 |
Information for unigene UN64553
FASTA Sequence |
Unigene ID: UN64553 | Length: 240 |
SSR | | GGAACTAACAGTGCCTACCAGTCTCTCTCTCTCTCTCACAATCTATCCTGGTGCGTGCGTCAATGGCGACTCAAGGACAGGTTATC
ACATGCAAAGCTGCGGTGGCATACGAGGCGAACAAACCACTGGTGATCGAAGATGTGCAGGTGGCTCCCCCTCAGGCCGGTGAGGT
TCGGATCAAGATCCTCTTCACCGCTCTCTGTCACACCGACGCCTACACTTGGAGCGGCAAGGATCCCG
|
|
|
GenBank top hits (Blast detail) | Score | e value |
ACR40091 S-nitrosoglutathione reductase [Brassica juncea] | 304 | 2e-026 |
NP_199207 alcohol dehydrogenase class-3 [Arabidopsis thaliana] | 301 | 5e-026 |
AAB06322 glutathione-dependent formaldehyde dehydrogenase [Arabidopsis thaliana] | 301 | 5e-026 |
CAA57973 class III ADH, glutathione-dependent formaldehyde dehydrogenase [Arabidopsis thaliana] | 301 | 5e-026 |
CAN61500 hypothetical protein VITISV_011731 [Vitis vinifera] | 298 | 1e-025 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q96533 Alcohol dehydrogenase class-3 | 301 | 2e-027 |
P93629 Alcohol dehydrogenase class-3 | 288 | 6e-026 |
A2XAZ3 Alcohol dehydrogenase class-3 | 283 | 2e-025 |
Q0DWH1 Alcohol dehydrogenase class-3 | 280 | 5e-025 |
P80572 Alcohol dehydrogenase class-3 | 260 | 1e-022 |
TrEMBL top hits (Blast detail) | Score | e value |
C4PKK5 S-nitrosoglutathione reductase (Fragment) | 304 | 2e-026 |
A5BL32 Putative uncharacterized protein | 298 | 8e-026 |
D2Y3F4 Alcohol dehydrogenase class III | 294 | 2e-025 |
Q2XPW7 Alcohol dehydrogenase class III-like protein | 294 | 2e-025 |
B9T5W1 Alcohol dehydrogenase, putative | 293 | 3e-025 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT5G43940.1 HOT5 (sensitive to hot temperatures 5); S-(hydroxymethyl)glutathione dehydrogenase/ S-nitrosoglutathione reductase | 301 | 1e-028 |
AT1G77120.1 ADH1 (ALCOHOL DEHYDROGENASE 1); alcohol dehydrogenase | 225 | 9e-020 |
AT1G64710.1 alcohol dehydrogenase, putative | 208 | 9e-018 |
AT1G22440.1 alcohol dehydrogenase, putative | 173 | 1e-013 |
AT1G32780.1 alcohol dehydrogenase, putative | 171 | 2e-013 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
 |
|
|