Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN64583

FASTA Sequence
Unigene ID: UN64583Length: 490 SSR 
GGCGACCCCAGGTCAGGCGGGATCACCCGCTGAGTTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGT
AACGTCGAGGCTTTCGCGGGAAGAGATACCCTCAAGGTTCCTTACGAGTCGCGTGGCATTGGAGGGTTTAAACGAGCTTCGATACG
GTTCGTGGCGGTTTCGACGAGAACTAGAGTTATGTTCTACAGCACTTTCTATGCCATGAGGAGCGATGATTTCTCGTCCTTGTGTG
GGCCTGTGATTGATGATGTTAAGCTTATAAGCGTTCGTCAGCGGTAGATGAATGGATTATTATTATTATTATTATTACAAGAAATG
AAGTGTGTGTGGGGTTTTATTTTCAAAAAAGAAAAAAAAATACTGTCTTTTGGTGTGTTTTGATTTTTATTCAAAAGATATGTATA
AGGTGACGGTTTATTTAGGGTTTATAATGTATTTTCTTGTATGAGAAGGCAAATGAAGGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197928 uncharacterized protein [Arabidopsis thaliana]3363e-030
BAD93856 hypothetical protein [Arabidopsis thaliana]3363e-030
BAH57107 AT5G25460 [Arabidopsis thaliana]3363e-030
AAM61720 unknown [Arabidopsis thaliana]3311e-029
AAL06839 AT5g25460/F18G18_200 [Arabidopsis thaliana]3302e-029

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
C0Z328 AT5G25460 protein3362e-030
Q56XA8 Putative uncharacterized protein At5g25460 (Fragment)3362e-030
Q94F20 At5g254603362e-030
Q8LEX7 Putative uncharacterized protein3319e-030
Q940Q9 AT5g25460/F18G18_2003301e-029

Arabidopsis top hits (Blast detail)Scoree value
AT5G25460.1 unknown protein3363e-032
AT5G11420.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cell wall, plant-type cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G25460.1); Has 185 Blast hits to 157 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 185; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).3274e-031
AT4G32460.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11420.1); Has 182 Blast hits to 158 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).3167e-030
AT4G32460.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: plant-type cell wall; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF642 (InterPro:IPR006946), Galactose-binding like (InterPro:IPR008979); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G11420.1); Has 182 Blast hits to 158 proteins in 12 species: Archae - 0; Bacteria - 2; Metazoa - 0; Fungi - 0; Plants - 180; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).3167e-030
AT1G80240.1 unknown protein2101e-017

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members