 |
Information for unigene UN67000
FASTA Sequence |
Unigene ID: UN67000 | Length: 490 |
SSR | | GGACTCCAAAAACGATCGATCAATCTGAATCTTCTCATTTTCCCCCTTTCTCCGTTTCATAGCTAGCTAGGGTTTCGAGATGGGTC
AGATCCAGTACTCTGACAAATACTTCGACGATACTTTCGAGTACAGGCACGTCGTGCTTCCTCCTGAAGTCGCTAAGCTTCTCCCG
AAGAATCGTCTTCTCTCCGAAAATGAGTGGCGTGCGATTGGGGTGCAGCAGAGCCGTGGATGGGTCCATTACGCCATTCATCGTCC
AGAGCCACACATCATGCTGTTCAGGAGGACTCTCAATTACCAGCAGCAGCAGCAGGAGAACCAAGCTCAAAACCTGCTCGCTAAGT
GAATCTGAGTTGTGCTGCGCTACAAACATTGGTTCTTGTTAGCTATTATGTTTCTTGTAAACATGGGTTTGTGAACCCCACAACCT
CTAATAACTTTGTGTTCATGTTATCATCCTTGGTTGGCGAAAAACATGCGAGTGAATGAG
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002879125 cdk-subunit 1 [Arabidopsis lyrata subsp. lyrata] | 434 | 1e-041 |
NP_180363 cyclin-dependent kinases regulatory subunit 1 [Arabidopsis thaliana] | 433 | 2e-041 |
BAF36296 hypothetical protein [Ipomoea trifida] | 433 | 2e-041 |
XP_002523737 Cyclin-dependent kinases regulatory subunit, putative [Ricinus communis] | 429 | 5e-041 |
AAS79576 putative CDK regulatory subunit [Ipomoea trifida] | 428 | 7e-041 |
Swiss-Prot top hits (Blast detail) | Score | e value |
O23249 Cyclin-dependent kinases regulatory subunit 1 | 438 | 5e-043 |
A2XCH8 Cyclin-dependent kinases regulatory subunit 1 | 404 | 4e-039 |
Q6PS57 Cyclin-dependent kinases regulatory subunit 1 | 404 | 4e-039 |
Q9SJJ5 Cyclin-dependent kinases regulatory subunit 2 | 404 | 4e-039 |
P55933 Probable cyclin-dependent kinases regulatory subunit | 314 | 1e-028 |
TrEMBL top hits (Blast detail) | Score | e value |
A0A8Z1 Putative uncharacterized protein | 433 | 1e-041 |
B9SCL8 Cyclin-dependent kinases regulatory subunit, putative | 429 | 4e-041 |
Q6JJ57 Putative CDK regulatory subunit | 428 | 5e-041 |
Q6T300 Cyclin-dependent kinases regulatory subunit | 423 | 2e-040 |
A5AEC1 Putative uncharacterized protein | 420 | 4e-040 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT2G27960.1 CKS1 (CYCLIN-DEPENDENT KINASE-SUBUNIT 1); cyclin-dependent protein kinase/ protein binding | 439 | 4e-044 |
AT2G27970.1 CKS2 (CDK-subunit 2); cyclin-dependent protein kinase/ cyclin-dependent protein kinase regulator | 404 | 4e-040 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
 |
|
|