Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN67010

FASTA Sequence
Unigene ID: UN67010Length: 192 SSR 
GGAGGGAGGCGAGAGAGAGAGAGGTTCATTTCGATTTCGATTTCTCTTCGAAAAATTAAATTAATCCAGGGGGGGTGGAGGTGGAG
AGATGGTGAGGATGGTGAGAAGCTGCTTACAGTCGATGATGAAGCTGGTGAATTCCCTTGTTGGAATGGTTGGTGTCGCCCTGATC
CTCTACGCTGGTTGGCTCGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_179667 Tetraspanin family protein [Arabidopsis thaliana]1483e-008
AAD20922 unknown protein [Arabidopsis thaliana]1483e-008
XP_002884219 hypothetical protein ARALYDRAFT_480909 [Arabidopsis lyrata subsp. lyrata]1483e-008
XP_002517938 conserved hypothetical protein [Ricinus communis]1287e-006
ACU16551 unknown [Glycine max]1287e-006

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q940P5 At2g20740/F5H14.291482e-008
Q9SKU4 Putative uncharacterized protein At2g207301482e-008
B9RW19 Putative uncharacterized protein1285e-006
C6T4E1 Putative uncharacterized protein1285e-006

Arabidopsis top hits (Blast detail)Scoree value
AT2G20740.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: endomembrane system, integral to membrane; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Tetraspanin (InterPro:IPR018499); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT2G20230.1); Has 91 Blast hits to 91 proteins in 11 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 90; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).1488e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  100%

Unigene Members