 |
Information for unigene UN68744
FASTA Sequence |
Unigene ID: UN68744 | Length: 330 |
SSR | | GGGATTCTCTCATTCGCGCGCGCGCTCTTTCTCTCTCTCTCTCTATCTCACGGCGGGCGATTCTTCCCTGCTCCGGCGAAGATAGA
AACTTGAAATTGATGGTTGTAAAGGCGGAGACTTCACCTAGTAGTGTTGTTTGCTTAGGATGAACGGTGCTCCCTTTTGCGATCGT
AGAGGGTTTCTGCTTTTAGGTTTTACTACCTCTCTCTCACTCCCATTCCTTCGATGGGTGGTCTTGGTTTCTCAGCTAGTAGTGTA
ACCGAGAGTTTGAAGAAGACTAATGAGCTTCTGAACCAGGAAGTGGTAAAATTACGTGCTCACGTAAACTTG
|
|
|
GenBank top hits (Blast detail) | Score | e value |
XP_002863817 hypothetical protein ARALYDRAFT_917597 [Arabidopsis lyrata subsp. lyrata] | 136 | 7e-007 |
XP_002526126 Ran GTPase binding protein, putative [Ricinus communis] | 132 | 2e-006 |
NP_199029 Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain [Arabidopsis thaliana] | 129 | 4e-006 |
Swiss-Prot top hits | Score | e value |
No hits found | | |
TrEMBL top hits (Blast detail) | Score | e value |
B9SJF7 Ran GTPase binding protein, putative | 132 | 1e-006 |
Q9FHX1 TMV resistance protein-like | 129 | 3e-006 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT5G42140.1 zinc finger protein, putative / regulator of chromosome condensation (RCC1) family protein | 129 | 1e-008 |
AT1G76950.1 PRAF1; Ran GTPase binding / chromatin binding / zinc ion binding | 108 | 3e-006 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
 |
|
|