Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN68744

FASTA Sequence
Unigene ID: UN68744Length: 330 SSR 
GGGATTCTCTCATTCGCGCGCGCGCTCTTTCTCTCTCTCTCTCTATCTCACGGCGGGCGATTCTTCCCTGCTCCGGCGAAGATAGA
AACTTGAAATTGATGGTTGTAAAGGCGGAGACTTCACCTAGTAGTGTTGTTTGCTTAGGATGAACGGTGCTCCCTTTTGCGATCGT
AGAGGGTTTCTGCTTTTAGGTTTTACTACCTCTCTCTCACTCCCATTCCTTCGATGGGTGGTCTTGGTTTCTCAGCTAGTAGTGTA
ACCGAGAGTTTGAAGAAGACTAATGAGCTTCTGAACCAGGAAGTGGTAAAATTACGTGCTCACGTAAACTTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002863817 hypothetical protein ARALYDRAFT_917597 [Arabidopsis lyrata subsp. lyrata]1367e-007
XP_002526126 Ran GTPase binding protein, putative [Ricinus communis]1322e-006
NP_199029 Regulator of chromosome condensation (RCC1) family with FYVE zinc finger domain [Arabidopsis thaliana]1294e-006

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
B9SJF7 Ran GTPase binding protein, putative1321e-006
Q9FHX1 TMV resistance protein-like1293e-006

Arabidopsis top hits (Blast detail)Scoree value
AT5G42140.1 zinc finger protein, putative / regulator of chromosome condensation (RCC1) family protein1291e-008
AT1G76950.1 PRAF1; Ran GTPase binding / chromatin binding / zinc ion binding1083e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members