Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN68809

FASTA Sequence
Unigene ID: UN68809Length: 565 SSR 
GGCTTTTAGTAAATTTTAAAACAAAACATAAAGAGAGAGATTTGTCTTTATCGTGGCTCGAGGCTTTGTCTCCTCTGCGCGTGGAA
ATTCTCGTTAGTGACTCTCACGATCTCTTCTCTCTCTCTCTCTCTCTTATAACTCGGATCACCACATGACTCAATCTCCTCCTCCT
TCCCGTTAAAACACAGAACCAAACTCCCTAAAGGGACATGGGGTTCGACGACGAAAACACTTCCAAAACGTCTCATCAACACGATG
GCACCGACGACGAGGGTGCTACTGGATCCTTGGGGAGGCAAATGAGCGAAGCCTCTCTTAGCGCTGCCGAGGAAGAAGAAGACGAT
GATTCCAAATTACAATTGGGTCCTCAGTACACTATCAAGGAACATCTCGAGAAGGATAAGGACGATGAGAGTCTGAGGAAGTGGAA
AGAACAGCTTCTCGGAAGTGTTGATGTCACCAACATTGGAGAGACTCTTGACCCTGAAGTGAAGATCATTAGCTTGGCCATCTTAT
CCCCCGGAAGACCTGATATCGTCCTTATGGTTCCGGAGAATGGGAATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_187445 Rho GDP-dissociation inhibitor 1 [Arabidopsis thaliana]4756e-046
XP_002882555 rho GDP-dissociation inhibitor family protein [Arabidopsis lyrata subsp. lyrata]4712e-045
XP_002532283 Rho GDP-dissociation inhibitor, putative [Ricinus communis]3824e-035
XP_002520560 Rho GDP-dissociation inhibitor, putative [Ricinus communis]3725e-034
XP_002308781 predicted protein [Populus trichocarpa]3691e-033

Swiss-Prot top hits (Blast detail)Scoree value
Q9SFC6 Rho GDP-dissociation inhibitor 14753e-047
Q61599 Rho GDP-dissociation inhibitor 21196e-006

TrEMBL top hits (Blast detail)Scoree value
Q541X0 Putative RHO GDP-dissociation inhibitor 14754e-046
B9T214 Rho GDP-dissociation inhibitor, putative3823e-035
B9S3J1 Rho GDP-dissociation inhibitor, putative3724e-034
B9HCG9 Predicted protein3698e-034
Q705X3 RHO protein GDP dissociation inhibitor3582e-032

Arabidopsis top hits (Blast detail)Scoree value
AT3G07880.1 Rho GDP-dissociation inhibitor family protein4753e-048
AT1G12070.1 Rho GDP-dissociation inhibitor family protein2836e-026
AT1G62450.1 Rho GDP-dissociation inhibitor family protein2773e-025

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members