Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN68933

FASTA Sequence
Unigene ID: UN68933Length: 656 SSR 
GGGCGGGTGCGAGTGATTAATTTCGATCCTTCCATAGAAAGATAAAGAGAGAGAGAGAGAAAAGCTTGCAACTTTGACGATTTCGA
CATCTAAAGGATTGTAATTGACTGCAAGAAAAAGATTCCTCCCTCTCCCTCCCTCGGGTACACACGTCTCTTTGAACTGCTTTTTG
TTGTTCTTTGTTTGATTGATTCCTCAGGTTTAGTCCCTTGGACCCATTTCTAGGTTACCCTTTTACGATTAGGATCGAAAAGTGTT
TCCTTTTTCCGTGACTATGTACAAGTTTTTGGTTCTTGGTTTTCGTGTTTTGTCTCAATTAGCTCAAAGCAAGAATCTTTCATTCA
TGACGACCAATTTCGATGACTCTTCAAAGCAACTCGTCTTGCTTGCATCTGTTTGTTCCGGCATCCTCATGTGCAAAATCGTTTAT
GACTTGACTGGTTTCATAAGTCCTTTGCTCTTCAGTGCTTATGGGAAACTCGATGGCAAAGTTAGAATGGAATGGAACAACAGGGG
ATTCTCAACGTTCCATGCTGTTTTTGTTTCCGTGGCATCAATCTATCTCCTGGTGATTTCAGATCAGTTTGATGAGAGTGTTCATG
GTGATTCGGTCATCAATAGTACAACGAGGTTATCCGAATCTGTAATGGGGGTGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33804 unnamed protein product [Thellungiella halophila]4802e-046
CAB39789 hypothetical protein [Arabidopsis thaliana]4561e-043
NP_567355 TRAM, LAG1 and CLN8 (TLC) lipid-sensing domain containing protein [Arabidopsis thaliana]4561e-043
AAM61723 unknown [Arabidopsis thaliana]4516e-043
XP_002872510 hypothetical protein ARALYDRAFT_911336 [Arabidopsis lyrata subsp. lyrata]4481e-042

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q93ZA9 AT4G10360 protein4561e-043
Q9SV86 Putative uncharacterized protein AT4g103604561e-043
Q8LEX4 Putative uncharacterized protein4514e-043
C6T7Q6 Putative uncharacterized protein2883e-024
B9IQX6 Predicted protein2713e-022

Arabidopsis top hits (Blast detail)Scoree value
AT4G10360.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink).4567e-046
AT4G10360.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 453 Blast hits to 451 proteins in 101 species: Archae - 0; Bacteria - 0; Metazoa - 225; Fungi - 97; Plants - 91; Viruses - 3; Other Eukaryotes - 37 (source: NCBI BLink).4567e-046
AT1G31300.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).1942e-015
AT1G31300.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19645.2); Has 478 Blast hits to 478 proteins in 104 species: Archae - 0; Bacteria - 0; Metazoa - 269; Fungi - 98; Plants - 80; Viruses - 0; Other Eukaryotes - 31 (source: NCBI BLink).1942e-015
AT4G19645.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: integral to membrane; CONTAINS InterPro DOMAIN/s: TRAM, LAG1 and CLN8 homology (InterPro:IPR006634); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G31300.2); Has 401 Blast hits to 401 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 186; Fungi - 102; Plants - 84; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).1636e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members