Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN69216

FASTA Sequence
Unigene ID: UN69216Length: 514 SSR 
GGATGTCCGTTATTGTTAGCTTTGGTCCTACAGAGCCAACCAGAGAGAAGAACAAGTAGTAGTAGAAGAAGATCAGAGATTAACAT
TAATCATTAGAGACCATGGGGAAAGTCTTGAAAGCTTATCAAGAACAATGGGTTTAACTCTGTTCTCGATCACGTGATCTTGAAAC
TTTCTCTCCTCTTCACGGTGGTCCATGGAGATGGATGTTGAATCCGTGCTTCAGTTTCTCCGACGTAACGGCTTAACGGAGGCTGA
GTCTGCTCTGAGAGACGATATCAACGAGCAAAACCAACTCATTTCTTTTGACTTCGTGAAGTTTCTGTTTCCTATTCCTCCGCCGA
TCAGAATCACGGCGAGTCCTCTCCCTCATCCTCCTGATTCCTCCAAGTCTTCTTCAGAGGAAGAGTTTCAGCTTGGACTCTTTCAC
TTCCGGGTTTGTGAATCCGTATGGAGATGGTTCATCATCATCATCATCTGAATCCATGTCTCAGTTTGGTACGGCGCGTACATA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_181541 protein kinase-like protein [Arabidopsis thaliana]2452e-019
ACU14915 unknown [Glycine max]1808e-012
XP_002272072 PREDICTED: hypothetical protein [Vitis vinifera]1592e-009
XP_002315156 predicted protein [Populus trichocarpa]1548e-009
XP_002533381 ATP binding protein, putative [Ricinus communis]1531e-008

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9XEE4 Hypothetical Ser-Thr protein kinase2452e-019
C6T092 Putative uncharacterized protein (Fragment)1805e-012
B9HSN4 Predicted protein1546e-009
B9T562 ATP binding protein, putative1537e-009
B9HHQ2 Predicted protein1474e-008

Arabidopsis top hits (Blast detail)Scoree value
AT2G40120.1 protein kinase family protein2451e-021
AT1G06630.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G60040.1); Has 1188 Blast hits to 1155 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1187; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).1439e-010
AT1G06630.3 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Cyclin-like F-box (InterPro:IPR001810), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT3G60040.1).1439e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  100%

Unigene Members