Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN69827

FASTA Sequence
Unigene ID: UN69827Length: 207 SSR 
GGAAACTCTCTTGTCTAACCCTGTTCCCCCTCTTCCTCTTCTACCTTGGGTTCTTCCCCCTCTTCCCCTTCTTCCTTGGGTTCTTC
CCCCTCTTTGGTTTCTTCTTTGGTTTCCCCCTCTTTGGTTTCTTCTTTGGGGGCTTCCTTCTCCTGCTTCTTCTTCTTCTTGCCCT
TCAACTTATCCACCAAAATCTGCAAAGGCTTGGAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002727304 PREDICTED: hypothetical protein [Rattus norvegicus]1403e-007
CBJ33866 conserved unknown protein [Ectocarpus siliculosus]1384e-007
CBZ56390 Methyltransferase-like protein, related [Neospora caninum Liverpool]1384e-007
XP_001615671 hypothetical protein [Plasmodium vivax SaI-1]1341e-006
EFZ00339 hypothetical protein MAA_04116 [Metarhizium anisopliae ARSEF 23]1332e-006

Swiss-Prot top hits (Blast detail)Scoree value
P48988 Major centromere autoantigen B1273e-007
P07199 Major centromere autoantigen B1239e-007
P27790 Major centromere autoantigen B1221e-006
P35616 Neurofilament light polypeptide1174e-006
P22620 101 kDa malaria antigen1166e-006

TrEMBL top hits (Blast detail)Scoree value
A5K340 Putative uncharacterized protein1349e-007
A0NCD0 AGAP000575-PA (Fragment)1303e-006
A9UQ72 Predicted protein1276e-006
C6T3P8 Putative uncharacterized protein1268e-006
B2W824 Putative uncharacterized protein1251e-005

Arabidopsis top hits (Blast detail)Scoree value
AT1G01490.1 heavy-metal-associated domain-containing protein1192e-007
AT1G01490.2 heavy-metal-associated domain-containing protein1192e-007
AT5G03710.1 unknown protein1139e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members