Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN69879

FASTA Sequence
Unigene ID: UN69879Length: 438 SSR 
CAATCCCCTTATCAAACTAAAAACCCCAAGTTTTCGATTTCACATTTTTATAACACAAAGAAAGAAACAAACTACAAACAGACATC
CAATACAGCTTTCTCTTTTTTTCTACTTGCTTCTTTTTTTCTTTTCTATTAGCTGGGATGCTTAGTAGGGCCTGTACCTTCGGCCT
CCCCCTCGGCTACCATCATGATCATCACTGTTCTCTCCCCCTGACCCTCTGCTTGAGCCATTATTCCGGTCACCTCTTCTGGGTCG
TTGTGGTGGTGGTGGTGCCATCTGCAAACCAGGCTGCTGCAAAACATAGCCAACACGGCCATCAGGAAAAAGCATTGGAACCATTT
GCATCCCTGTTGGCATTGATCCTCTACCATAAATCATTGGCTGACTAAAGCTACCGGCAATACCCAAACCAAACCCCATAGCACCA
TAAGCAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAB62861 similar to nucleolin protein [Arabidopsis thaliana]4126e-039
NP_567192 RNA recognition motif-containing protein [Arabidopsis thaliana]4126e-039
NP_001190647 RNA recognition motif-containing protein [Arabidopsis thaliana]4126e-039
NP_001190648 RNA recognition motif-containing protein [Arabidopsis thaliana]4126e-039
XP_002875012 RNA recognition motif-containing protein [Arabidopsis lyrata subsp. lyrata]4091e-038

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
O23093 A_TM018A10.14 protein4124e-039
Q9ASP6 AT4g00830/A_TM018A10_144124e-039
B9I936 Predicted protein2781e-023
B9SVF8 Nucleolar phosphoprotein, putative2637e-022
Q2HTD6 RNA-binding region RNP-1 (RNA recognition motif); Calcium-binding EF-hand2583e-021

Arabidopsis top hits (Blast detail)Scoree value
AT4G00830.1 RNA recognition motif (RRM)-containing protein4205e-042
AT4G00830.2 RNA recognition motif (RRM)-containing protein4205e-042
AT3G52660.1 RNA recognition motif (RRM)-containing protein1921e-015
AT3G52660.2 RNA recognition motif (RRM)-containing protein1921e-015
AT5G28390.1 RNA recognition motif (RRM)-containing protein1652e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members