Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN70033

FASTA Sequence
Unigene ID: UN70033Length: 611 SSR 
GGATCTCATCCACATTTCTCTCACCCACTTTCTCTCTCTCTCTCTCTCTCTCCGCGCTTTTGTATTTTTAAAATAGTGAGAATCTC
AAAAATAAAATAAAAAAACATTTGAGAGAAAAATAGAGAAAGGAGATCGTGAGAGACAGGGAGGCAGAGCCGAAGGAGGAAATCTT
AACTCGAGCATCAAGTGTGTGGGTGATGATGAATAAAGTGACAAGGAGACTATCAAAGCTTCCTGAAGAAGTTCGAGGGGAGATAG
AGCCTTACTTTGTGAACTCTGACCCTATCCTTGCAGAGGACAGCAGGAAGTTAACAAAACTAGATGACAAGACTGCTGACTATGTT
CGCTCTGGTCTCACCCCGAGATGGAGTGACTTGGACGTTAACCAGCATGTTAACAACGTGAAGTACATCGGGTGGATACTCGAGAG
TGCTCCCGTGGAGATGATGGAGAAGCATAAGCTGAAAAGCATGACTCTCGAGTATCGGAGGGAATGCGGGAGAGACAGTGTGCTTC
AGTCTCTAACCGCGGTTTCGGGATGCGATGTTGGTAACATTGGGACGGCTGGTGAAGTGGAGTGTCAGCATTTGCTTCGACTCCAG
GATGGAGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABH11710 palmitoyl-ACP thioesterase [Brassica napus]7472e-077
ACR56793 stearoyl ACP thioesterase [Brassica juncea]7364e-076
ACR56794 stearoyl ACP thioesterase [Brassica juncea]7312e-075
ABI18986 palmitoyl-ACP thioesterase [Brassica juncea]7302e-075
ACR56792 stearoyl ACP thioesterase [Brassica juncea]7302e-075

Swiss-Prot top hits (Blast detail)Scoree value
Q9SQI3 Myristoyl-acyl carrier protein thioesterase, chloroplastic6072e-062
Q39513 Myristoyl-acyl carrier protein thioesterase, chloroplastic5221e-052
Q39473 Myristoyl-acyl carrier protein thioesterase, chloroplastic4413e-043
Q41635 Lauroyl-acyl carrier protein thioesterase, chloroplastic4306e-042
Q42712 Oleoyl-acyl carrier protein thioesterase, chloroplastic (Fragment)2991e-026

TrEMBL top hits (Blast detail)Scoree value
Q0MT79 Palmitoyl-ACP thioesterase7472e-077
D6BND4 Stearoyl ACP thioesterase7363e-076
D6BND5 Stearoyl ACP thioesterase7311e-075
D6BND3 Stearoyl ACP thioesterase7301e-075
D6BND6 Stearoyl ACP thioesterase7301e-075

Arabidopsis top hits (Blast detail)Scoree value
AT1G08510.1 FATB (fatty acyl-ACP thioesterases B); acyl carrier/ acyl-[acyl-carrier-protein] hydrolase7237e-077
AT3G25110.1 AtFaTA (Arabidopsis FatA acyl-ACP thioesterase); acyl carrier/ acyl-[acyl-carrier-protein] hydrolase3007e-028
AT4G13050.1 acyl-(acyl carrier protein) thioesterase, putative / acyl-ACP thioesterase, putative / oleoyl-(acyl-carrier protein) hydrolase, putative / S-acyl fatty acid synthase thioesterase, putative2991e-027

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  100%

Unigene Members