 |
Information for unigene UN70982
| FASTA Sequence |
| Unigene ID: UN70982 | Length: 676 |
SSR | | GGAAGCTTTGTGGGGGAAACAAGTAAATGTTGTCTGGTTCAGTGTACGGGCATGTTTAGCCTCGAGAGGGATCATGCTATCTCTGC
GACTCACTCGCAGATTCTGCTCTTCTTCTTCTTCTTCTTCTTCCTCTGGTGTTTTTGCCCCCTCCTGCTTTCCCCACCTTCCAGCT
GAATCCAATCAGGAGGAGCCTCCTGCCCTTGTCAAGCTTAAATCTGAGCGAGACCCTCACAAGCTATTCAACCTCTTCAAAGCTAA
CGCCACTAACCACCTGGTGATTGAGAATCGTTTTGCTTTCGAGGACACTGTTTCTAGATTAGCCGGTGCACGTCGGTTTGATTTCA
TCTAGGATCTGCTTGAGCATCAGAAGACACTTCCACAAGGCAGGCGCGAGGGCTTCATTGTTAGGATTATTATGCTATACGGCAAG
GCTGGGATGACCAATCACGCCCTCGATACTTTCTACAATATGGATTCTTACGGCTGCAAGAGGACTGTTAAGTCCTTCAACGCCGC
GCTTAAAGTCTTGACTTTGAGACCTGATCTCCACGCCATCCAGGACTTCCTTCTCCATGTCCCCTCCAAGTATGGGGTTGTAATGG
ATGCGTTTTCGTTTAACATTGCTATTAAATCTGTCTGTGACATGGGGTTTCTTGACAAGGCGTCTCTGGCCATG
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| NP_178132 pentatricopeptide repeat-containing protein [Arabidopsis thaliana] | 688 | 2e-070 |
| AAD55488 Hypothetical protein [Arabidopsis thaliana] | 688 | 2e-070 |
| XP_002889307 pentatricopeptide repeat-containing protein [Arabidopsis lyrata subsp. lyrata] | 688 | 2e-070 |
| BAC43646 unknown protein [Arabidopsis thaliana] | 685 | 4e-070 |
| BAJ53230 JHL06P13.10 [Jatropha curcas] | 670 | 2e-068 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q8GW57 Pentatricopeptide repeat-containing protein At1g80150, mitochondrial | 688 | 1e-071 |
| Q9LK57 Pentatricopeptide repeat-containing protein At3g13160, mitochondrial | 247 | 1e-020 |
| Q9M065 Pentatricopeptide repeat-containing protein At4g36680, mitochondrial | 246 | 2e-020 |
| Q9LG23 Pentatricopeptide repeat-containing protein At1g55890, mitochondrial | 241 | 6e-020 |
| Q9ZU67 Pentatricopeptide repeat-containing protein At2g18520, mitochondrial | 221 | 1e-017 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| B9RV44 Pentatricopeptide repeat-containing protein, putative | 651 | 3e-066 |
| B9GWC5 Predicted protein | 631 | 6e-064 |
| B9GKW6 Predicted protein | 612 | 9e-062 |
| Q2HUC1 Pentatricopeptide repeat | 489 | 2e-047 |
| C5YJ88 Putative uncharacterized protein Sb07g028400 | 460 | 4e-044 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT1G80150.1 pentatricopeptide (PPR) repeat-containing protein | 688 | 9e-073 |
| AT3G13160.1 pentatricopeptide (PPR) repeat-containing protein | 247 | 1e-021 |
| AT4G36680.1 pentatricopeptide (PPR) repeat-containing protein | 246 | 2e-021 |
| AT1G55890.1 pentatricopeptide (PPR) repeat-containing protein | 241 | 6e-021 |
| AT2G18520.1 pentatricopeptide (PPR) repeat-containing protein | 221 | 1e-018 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
