 |
Information for unigene UN70982
FASTA Sequence |
Unigene ID: UN70982 | Length: 676 |
SSR | | GGAAGCTTTGTGGGGGAAACAAGTAAATGTTGTCTGGTTCAGTGTACGGGCATGTTTAGCCTCGAGAGGGATCATGCTATCTCTGC
GACTCACTCGCAGATTCTGCTCTTCTTCTTCTTCTTCTTCTTCCTCTGGTGTTTTTGCCCCCTCCTGCTTTCCCCACCTTCCAGCT
GAATCCAATCAGGAGGAGCCTCCTGCCCTTGTCAAGCTTAAATCTGAGCGAGACCCTCACAAGCTATTCAACCTCTTCAAAGCTAA
CGCCACTAACCACCTGGTGATTGAGAATCGTTTTGCTTTCGAGGACACTGTTTCTAGATTAGCCGGTGCACGTCGGTTTGATTTCA
TCTAGGATCTGCTTGAGCATCAGAAGACACTTCCACAAGGCAGGCGCGAGGGCTTCATTGTTAGGATTATTATGCTATACGGCAAG
GCTGGGATGACCAATCACGCCCTCGATACTTTCTACAATATGGATTCTTACGGCTGCAAGAGGACTGTTAAGTCCTTCAACGCCGC
GCTTAAAGTCTTGACTTTGAGACCTGATCTCCACGCCATCCAGGACTTCCTTCTCCATGTCCCCTCCAAGTATGGGGTTGTAATGG
ATGCGTTTTCGTTTAACATTGCTATTAAATCTGTCTGTGACATGGGGTTTCTTGACAAGGCGTCTCTGGCCATG
|
|
|
GenBank top hits (Blast detail) | Score | e value |
NP_178132 pentatricopeptide repeat-containing protein [Arabidopsis thaliana] | 688 | 2e-070 |
AAD55488 Hypothetical protein [Arabidopsis thaliana] | 688 | 2e-070 |
XP_002889307 pentatricopeptide repeat-containing protein [Arabidopsis lyrata subsp. lyrata] | 688 | 2e-070 |
BAC43646 unknown protein [Arabidopsis thaliana] | 685 | 4e-070 |
BAJ53230 JHL06P13.10 [Jatropha curcas] | 670 | 2e-068 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q8GW57 Pentatricopeptide repeat-containing protein At1g80150, mitochondrial | 688 | 1e-071 |
Q9LK57 Pentatricopeptide repeat-containing protein At3g13160, mitochondrial | 247 | 1e-020 |
Q9M065 Pentatricopeptide repeat-containing protein At4g36680, mitochondrial | 246 | 2e-020 |
Q9LG23 Pentatricopeptide repeat-containing protein At1g55890, mitochondrial | 241 | 6e-020 |
Q9ZU67 Pentatricopeptide repeat-containing protein At2g18520, mitochondrial | 221 | 1e-017 |
TrEMBL top hits (Blast detail) | Score | e value |
B9RV44 Pentatricopeptide repeat-containing protein, putative | 651 | 3e-066 |
B9GWC5 Predicted protein | 631 | 6e-064 |
B9GKW6 Predicted protein | 612 | 9e-062 |
Q2HUC1 Pentatricopeptide repeat | 489 | 2e-047 |
C5YJ88 Putative uncharacterized protein Sb07g028400 | 460 | 4e-044 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT1G80150.1 pentatricopeptide (PPR) repeat-containing protein | 688 | 9e-073 |
AT3G13160.1 pentatricopeptide (PPR) repeat-containing protein | 247 | 1e-021 |
AT4G36680.1 pentatricopeptide (PPR) repeat-containing protein | 246 | 2e-021 |
AT1G55890.1 pentatricopeptide (PPR) repeat-containing protein | 241 | 6e-021 |
AT2G18520.1 pentatricopeptide (PPR) repeat-containing protein | 221 | 1e-018 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
 |
|
|