 |
Information for unigene UN73718
| FASTA Sequence |
| Unigene ID: UN73718 | Length: 524 |
SSR | | AACAAATGAATCTGACAACCCCTCTCTCTCTCTCTCTCTTTCTCTTTGCTTGCTTCATTTCATTCTGCTGTTACCTTGATCTGTCC
ATAAAGATTAGGGTCTGCTTCATAGTATACAACATCTCCTTCATCGCTCACAAAATGATCTTCTTTAATACTTTTTGCTAAAATTC
CCAGTAAGTGTAACGGCAAAGGTCCAGACTTATCAGGCTCCCTATAATACTTCCCTAATACTGGTTTAACTGCTTCCGTTGCTTCT
ACTAAATGGTAATGTGGGATCTGCGGGAAAAGATGATGTATCACATGAGTTCCAATGTCGTGATGGATGTTGTTGATCAATCCGTA
ATCACGGTCCAGTGTTGTAAGCCCTCCTCTCAAGTAACTCCATTCCTTCCCACGGTACCAAGGGAGCTTATCTTCATGACCATGGT
GATGAAGGTAAGTCACAAAGTCCAACCACATTACATTTATCCAGTAAGGAACTACATAAAGTTTGAGCATTTGCATAGGACCCATC
ACAAAGTT
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| P48618 RecName: Full=Omega-3 fatty acid desaturase, chloroplastic; Flags: Precursor | 851 | 1e-089 |
| AAA61774 omega-3 fatty acid desaturase [Brassica napus] | 851 | 1e-089 |
| ACS26170 chloroplast fatty acid desaturase 7 [Brassica napus] | 848 | 3e-089 |
| AAT02410 chloroplast omega-3 fatty acid desaturase [Brassica napus] | 842 | 1e-088 |
| CAB85467 chloroplast omega-3 fatty acid desaturase [Brassica juncea] | 816 | 1e-085 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| P48618 Omega-3 fatty acid desaturase, chloroplastic (Fragment) | 851 | 7e-091 |
| P46310 Omega-3 fatty acid desaturase, chloroplastic | 803 | 3e-085 |
| P48622 Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic | 751 | 3e-079 |
| P48619 Omega-3 fatty acid desaturase, chloroplastic | 727 | 2e-076 |
| P48620 Omega-3 fatty acid desaturase, chloroplastic | 696 | 7e-073 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| C5J3R0 Chloroplast fatty acid desaturase 7 | 848 | 2e-089 |
| Q6PN70 Chloroplast omega-3 fatty acid desaturase | 842 | 1e-088 |
| Q9M4D4 Chloroplast omega-3 fatty acid desaturase | 816 | 1e-085 |
| B4X945 Chloroplast omega-3 fatty acid desaturase | 813 | 2e-085 |
| A1E436 Omega-3 fatty acid desaturase | 807 | 1e-084 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT3G11170.1 FAD7 (FATTY ACID DESATURASE 7); omega-3 fatty acid desaturase | 804 | 2e-086 |
| AT5G05580.1 FAD8 (FATTY ACID DESATURASE 8); omega-3 fatty acid desaturase | 751 | 3e-080 |
| AT2G29980.1 FAD3 (FATTY ACID DESATURASE 3); omega-3 fatty acid desaturase | 640 | 2e-067 |
| AT3G12120.1 FAD2 (FATTY ACID DESATURASE 2); delta12-fatty acid dehydrogenase/ omega-6 fatty acid desaturase | 257 | 5e-023 |
| AT3G12120.2 FAD2 (FATTY ACID DESATURASE 2); delta12-fatty acid dehydrogenase/ omega-6 fatty acid desaturase | 257 | 5e-023 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
