Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN73769

FASTA Sequence
Unigene ID: UN73769Length: 381 SSR 
GGTGCTATGTTCAGGAGAAAAGCTTTCCTTCATTGGTACACGGGAGAAGGAATGGACGAGATGGAGTTCACCGAAGCTGAGAGTAA
CATGAACGATCTTGTTGCTGAGTACCAGCAATATCAGGATGCTACAGTCGGTGAAGAAGAGTATGAGGAGGAAGAAGAAGAAGAAG
CTTAAGAAGACATGATTGATTACTACTTTCACACAAGCTGTAAGTCGTGTCATTCATTTCTTTGTTATGTTTGTTCCTTTGAATTG
AAGTTTCTCTCTTTATGTGCTTTGTGTGTTTTGTTATTGAAACAAGATTTGTACTTGAATGTAAAATCCCTTATGCTCTATGCAAA
CATTTCAATGTCAAGCCTATACAGTTACTGAGGTTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_193821 tubulin beta-9 chain [Arabidopsis thaliana]2952e-025
BAH20375 AT4G20890 [Arabidopsis thaliana]2952e-025
XP_002330612 tubulin, beta chain [Populus trichocarpa]2908e-025
NP_199247 tubulin beta-4 chain [Arabidopsis thaliana]2891e-024
AAA32757 beta-tubulin [Arabidopsis thaliana]2891e-024

Swiss-Prot top hits (Blast detail)Scoree value
P29517 Tubulin beta-9 chain2958e-027
P24636 Tubulin beta-4 chain2894e-026
Q41784 Tubulin beta-7 chain2832e-025
P12460 Tubulin beta-2 chain2813e-025
Q40665 Tubulin beta-3 chain2804e-025

TrEMBL top hits (Blast detail)Scoree value
B9DI08 AT4G20890 protein (Fragment)2952e-025
B9N5R3 Tubulin, beta chain2906e-025
Q6LAB6 Tubulin beta 4 chain (Fragment)2898e-025
B9GH00 Tubulin, beta chain2843e-024
C5NU06 Tubulin beta chain2843e-024

Arabidopsis top hits (Blast detail)Scoree value
AT4G20890.1 TUB9; GTP binding / GTPase/ structural molecule2951e-027
AT5G44340.1 TUB4; structural constituent of cytoskeleton2895e-027
AT1G20010.1 TUB5; structural constituent of cytoskeleton2653e-024
AT5G12250.1 TUB6 (BETA-6 TUBULIN); structural constituent of cytoskeleton2635e-024
AT1G75780.1 TUB1; GTP binding / GTPase/ structural molecule2619e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  100%

Unigene Members