Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN74421

FASTA Sequence
Unigene ID: UN74421Length: 322 SSR 
GGTGGTGAGAACGTTTACAATTCTGGTCGTTGGATGCCACCGGCCACTGGGGAACTCCGTCCTGATGTCTGGTGATCTCTTCTTAG
TTTCTCTCACAAAGTCAGTCATATGATGATGATGATGATGATGATGAATGAATGTTTCAGTGAGGATTAATAATATGTTATCTTTT
TCATCGGATAATATGAGAAAGAATGATCCAACAGACCGTTGTTCTTGGTTTTGGTTTTGCTTGAATATTAATCTTTTTTGTTTCAA
TTGTAAAACGAGACAACAACAATGAGTTTCGTCAGACATCAAATAAAACCTTTCAGTCCGGTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_171957 GRIM-19 protein [Arabidopsis thaliana]1367e-007
NP_565761 NADH dehydrogenase [Arabidopsis thaliana]1367e-007
ACT82817 At2g33220 [Arabidopsis thaliana]1367e-007
XP_002892230 hypothetical protein ARALYDRAFT_470446 [Arabidopsis lyrata subsp. lyrata]1367e-007
AAQ84313 fiber protein Fb20 [Gossypium barbadense]1322e-006

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
C7BCB6 At2g33220 (Fragment)1365e-007
O49313 Expressed protein1365e-007
Q8RWA7 Putative uncharacterized protein At1g046301365e-007
Q6UA15 Fiber protein Fb20 (Fragment)1321e-006
A5ASQ0 Putative uncharacterized protein1275e-006

Arabidopsis top hits (Blast detail)Scoree value
AT1G04630.1 MEE4 (maternal effect embryo arrest 4)1371e-009
AT2G33220.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: photorespiration; LOCATED IN: mitochondrion, mitochondrial membrane, plastid, respiratory chain complex I; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: GRIM-19 (InterPro:IPR009346); BEST Arabidopsis thaliana protein match is: MEE4 (maternal effect embryo arrest 4) (TAIR:AT1G04630.1); Has 226 Blast hits to 226 proteins in 98 species: Archae - 0; Bacteria - 0; Metazoa - 125; Fungi - 53; Plants - 38; Viruses - 0; Other Eukaryotes - 10 (source: NCBI BLink).1371e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members