 |
Information for unigene UN74581
| FASTA Sequence |
| Unigene ID: UN74581 | Length: 668 |
SSR | | GCTTGCAACATATCCAAGTATTATTGACTTTAAAACTAATCTCCAAACATACAATCAATTTGCAAAATTCAGATGTAACATGAGTT
GCAACACACACACACACACACACACATACACAAGTATATTATTGACTTTAAAGTTGAAATACAAAGAGACATGTTTCTTTCTTTGA
AAGCTTTTTTATTTCTAGGACAGGTGACAAACAATATTGACCTTTGATGTTTGGTCTTTTCAGGAGGAAAATCTGTCGCGGTCATG
AGGCGAAAAGTAATCGATGTTTGGTCCATGAGGGATGATCCCAAACGGGTTTAACGTAGGGTGGCTTCCGTAATAATGTTGCTTGA
TGTGATCCATTTTCACAGTGCTGCTCATTCCATTGATTTGGTATACATCTTTTATGTAGTTGAAAATATTCGGATACTCTCTTAAG
AGTCTCTTGTTGCATTTGAAGTGAACCGCGTAAACCTCATCAAATCTTATAAGGGTGACGAATAACCGAACATCTGCTTCGGTAAA
AGTGTCTCCACAGATGTATCTTTGTTTTTCGAGTATTGTCTCACATCTCTCTACTGCTTCAAACACTTGGTTCACTGCCTCATTGT
AAGGTTCTTGTTTCCTAGCAAACCCACATCTATAAACACCATTGTTTATCCCATTGAAAACCCACT
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| NP_199315 putative glutathione S-transferase [Arabidopsis thaliana] | 736 | 5e-076 |
| XP_002865303 predicted protein [Arabidopsis lyrata subsp. lyrata] | 721 | 3e-074 |
| XP_002863527 hypothetical protein ARALYDRAFT_356549 [Arabidopsis lyrata subsp. lyrata] | 709 | 7e-073 |
| AAK44087 unknown protein [Arabidopsis thaliana] | 664 | 1e-067 |
| NP_193723 Intracellular chloride channel-like protein [Arabidopsis thaliana] | 664 | 1e-067 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| P42620 Uncharacterized protein yqjG | 418 | 2e-040 |
| O94524 Glutathione S-transferase omega-like 2 | 290 | 1e-025 |
| P36156 Glutathione S-transferase omega-like 2 | 206 | 7e-016 |
| Q04806 Glutathione S-transferase omega-like 3 | 199 | 5e-015 |
| P48239 Glutathione S-transferase omega-like 1 | 156 | 5e-010 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| Q9FL95 AT5g45020/K21C13_21 | 736 | 4e-076 |
| Q8H121 Putative uncharacterized protein At4g19880 | 664 | 8e-068 |
| Q94K62 Putative uncharacterized protein At4g19880 (Fragment) | 664 | 8e-068 |
| Q2KKB6 Glutathione transferase | 652 | 2e-066 |
| C6TGS1 Putative uncharacterized protein | 638 | 8e-065 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT5G45020.1 LOCATED IN: cellular_component unknown; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione S-transferase, predicted (InterPro:IPR016639), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19880.1); Has 1632 Blast hits to 1632 proteins in 489 species: Archae - 12; Bacteria - 907; Metazoa - 22; Fungi - 156; Plants - 57; Viruses - 0; Other Eukaryotes - 478 (source: NCBI BLink). | 737 | 2e-078 |
| AT4G19880.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Glutathione S-transferase, predicted (InterPro:IPR016639), Glutathione S-transferase, C-terminal (InterPro:IPR004046), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT5G45020.1); Has 1635 Blast hits to 1635 proteins in 489 species: Archae - 12; Bacteria - 905; Metazoa - 23; Fungi - 158; Plants - 57; Viruses - 0; Other Eukaryotes - 480 (source: NCBI BLink). | 665 | 4e-070 |
| AT5G44990.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Glutathione S-transferase, predicted (InterPro:IPR016639), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19880.1); Has 1632 Blast hits to 1632 proteins in 489 species: Archae - 12; Bacteria - 905; Metazoa - 23; Fungi - 156; Plants - 57; Viruses - 0; Other Eukaryotes - 479 (source: NCBI BLink). | 567 | 9e-059 |
| AT5G44990.2 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Glutathione S-transferase, predicted (InterPro:IPR016639), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933), Thioredoxin-like fold (InterPro:IPR012336); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19880.1); Has 1632 Blast hits to 1632 proteins in 489 species: Archae - 12; Bacteria - 905; Metazoa - 23; Fungi - 156; Plants - 57; Viruses - 0; Other Eukaryotes - 479 (source: NCBI BLink). | 567 | 9e-059 |
| AT5G44990.3 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: stem; CONTAINS InterPro DOMAIN/s: Glutathione S-transferase, predicted (InterPro:IPR016639), Glutathione S-transferase, C-terminal-like (InterPro:IPR010987), Glutathione S-transferase/chloride channel, C-terminal (InterPro:IPR017933); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G19880.1); Has 1562 Blast hits to 1562 proteins in 487 species: Archae - 12; Bacteria - 896; Metazoa - 23; Fungi - 156; Plants - 57; Viruses - 0; Other Eukaryotes - 418 (source: NCBI BLink). | 567 | 9e-059 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
