 |
Information for unigene UN74675
| FASTA Sequence |
| Unigene ID: UN74675 | Length: 679 |
SSR | | GGGAACAAGAGAGAGAGAGAGAATCAATCTAAAAAAAAAAAAATTAGGGTTTCCTCTGTCTCTCCCAACATGTGCCGTTCCAGATG
TTTACTCACCATTCCCAACCGGAGATTAACCCTAATTCGGTGTCTCTGCCTCCGCAACCTCTCGTCACATTCCTTATTAAGCTTCC
TTTTTAGTGGAGTTTCTACTTTGAGGGGTTAGGCCATGCTCCGCACTTATAAAGAAAGTAGAGAAAGAAATCAAAAAGCATTAGAG
CACTATCTGTTTAGGTGTCAAGGAGTCAGATAATGGTTTAGCTCCTTCTGGTCAATGAGATTTTGTGTCTGATATGATGCAAGAGG
AGAATGATTTGATTAACCATTAATGTTGCAGGTTGCAGAGTTTCTCTCGTTGGGGTTAAACCAACACCTATTATGTTATTGTTAGG
TGCTCCTGTTGTAAGCAATGATCAGTCTTCGAAGCTAACAAAATCATTTGATGCTAGAACCGTTTGGCCTCAATGCACCAGTATTG
GGAACATCTTAGGTTTGAGTCTTTTTAGCTTTCTTTTCACACTAGTTTTGTGTTTCTTTTTCATTATGGTTACTAACCTTTCTGCT
TGCTTAGATCTGTGTTGCTTCCTCAGATTTTTCTGTGTTGCGTTATTTCTTTATAAGATTTCATATGACAGGTTACA
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| AAC72873 contains similarity to cysteine proteases (Pfam: PF00112, E=.21, N=1) [Arabidopsis thaliana] | 185 | 4e-012 |
| BAG69285 cathepsin B-like cysteine protease [Raphanus sativus] | 185 | 4e-012 |
| NP_849281 cathepsin B [Arabidopsis thaliana] | 183 | 7e-012 |
| BAJ34434 unnamed protein product [Thellungiella halophila] | 174 | 8e-011 |
| NP_567215 cathepsin B [Arabidopsis thaliana] | 173 | 1e-010 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q9SSB4 26S protease regulatory subunit 7 homolog B | 136 | 1e-007 |
| Q9SSB5 26S protease regulatory subunit 7 homolog A | 128 | 8e-007 |
| Q9FXT9 26S protease regulatory subunit 7 | 125 | 2e-006 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| B5BQV5 Cathepsin B-like cysteine protease (Fragment) | 185 | 3e-012 |
| Q9SBB1 Putative cysteine protease | 185 | 3e-012 |
| Q9ZSI0 Cathepsin B-like cysteine protease | 183 | 5e-012 |
| Q94K85 Cathepsin B-like cysteine protease | 173 | 7e-011 |
| B9RN00 Cathepsin B, putative | 162 | 1e-009 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT4G01610.2 cathepsin B-like cysteine protease, putative | 183 | 3e-014 |
| AT4G01610.1 cathepsin B-like cysteine protease, putative | 173 | 5e-013 |
| AT1G02305.1 cathepsin B-like cysteine protease, putative | 156 | 4e-011 |
| AT1G53780.1 ATP binding / ATPase/ hydrolase/ nucleoside-triphosphatase/ nucleotide binding / peptidyl-prolyl cis-trans isomerase | 136 | 9e-009 |
| AT1G02300.1 cathepsin B-like cysteine protease, putative | 133 | 2e-008 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
