 |
Information for unigene UN75048
| FASTA Sequence |
| Unigene ID: UN75048 | Length: 157 |
SSR | | TTAAACACAGGACACTGACTTTATTTAACAACATGCAGAGAGAGACAATGAACCGGAAAATGGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGACGACTTGTGATGTCCATAAAGATTGGAATCCACAAAGCC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| CAF88611 unnamed protein product [Tetraodon nigroviridis] | 160 | 1e-009 |
| XP_001661300 single-minded [Aedes aegypti] | 152 | 1e-008 |
| XP_644032 hypothetical protein DDB_G0274557 [Dictyostelium discoideum AX4] | 151 | 1e-008 |
| XP_806018 RNA-binding protein 6 [Trypanosoma cruzi strain CL Brener] | 151 | 1e-008 |
| EFN86650 hypothetical protein EAI_03683 [Harpegnathos saltator] | 151 | 1e-008 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| Q8MP30 Uncharacterized histidine-rich protein DDB_G0274557 | 151 | 5e-010 |
| Q6ZQ93 Ubiquitin carboxyl-terminal hydrolase 34 | 148 | 1e-009 |
| TrEMBL top hits (Blast detail) | Score | e value |
|---|
| Q4TES1 Chromosome undetermined SCAF5157, whole genome shotgun sequence. (Fragment) | 160 | 9e-010 |
| Q16RB3 Single-minded | 152 | 8e-009 |
| Q4CV65 RNA-binding protein 6, putative | 151 | 1e-008 |
| Q54QY5 Putative uncharacterized protein | 150 | 1e-008 |
| A7SY14 Predicted protein (Fragment) | 149 | 2e-008 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
