Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN75175

FASTA Sequence
Unigene ID: UN75175Length: 275 SSR 
TATATAACTGCTCCAATTCGTTCGTGCCCTTCCTAAATCGAACTATACAATGGTTAAAATATCCTTAAAAAAACAGCCGTGTTGAA
TTTTCCTTTTGTTTGCTGCTATATGTACATGACATGAGCAAAAGTGCCATCTGACTTTACCTTCTGTTGCTATTTCTGGGGCTGTA
ATTTAGTCTACGAGCAGTCATACCCCTTCCTCCTCCTCCATTCCAACCTCTGTCATCATCATCATCATCGTTGTCATCCTCATTGT
AGGCTACTGCCTTTTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002873731 sister chromatid cohesion 2 [Arabidopsis lyrata subsp. lyrata]1904e-013
CAC01753 putative protein [Arabidopsis thaliana]1861e-012
NP_197058 cohesin loading factor subunit SCC2 [Arabidopsis thaliana]1861e-012
ABS88747 sister chromatid cohesion protein [Arabidopsis thaliana]1861e-012
NP_001190317 cohesin loading factor subunit SCC2 [Arabidopsis thaliana]1861e-012

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
A5HEI1 Sister chromatid cohesion 21868e-013
A7UDC4 Sister chromatid cohesion protein1868e-013
Q9LF28 Putative uncharacterized protein T20K14_1501868e-013

Arabidopsis top hits (Blast detail)Scoree value
AT5G15540.1 EMB2773 (EMBRYO DEFECTIVE 2773); binding / protein binding / zinc ion binding1872e-015

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members