Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN75502

FASTA Sequence
Unigene ID: UN75502Length: 335 SSR 
ACGTTTTCTGTAGTTTAACCAAAACCTAAAAGGAGCAAGAATAAAAAAAAAAAGAATACATATACTTATAGATGTGACATAGCTTT
TGGGAGTGTTTCATTCACTGAAGTCCACACTTCCACTGCGTGAGCTGCTACCACTGTGCACAAAAAGACCTCTCATATGACCTGGC
AAACCCGAGGCACCACCATCAACCTTCTTCTCCTTGAAAAACTTCTGCCTCTCGACGTGTTTTGCAGGGGGCGGTGGAATCACAAC
AGGCGAGGAGGAGGAGGAGGAGGACTGCGAATGGCCATCACTACTGCGTGGTGACTCCTCTGATGGTAAAGGACGAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002864859 VHS domain-containing protein [Arabidopsis lyrata subsp. lyrata]2891e-024
BAJ34493 unnamed protein product [Thellungiella halophila]2828e-024
NP_201169 ENTH/VHS/GAT family protein [Arabidopsis thaliana]2711e-022
XP_002513254 Hepatocyte growth factor-regulated tyrosine kinase substrate, putative [Ricinus communis]2111e-015
XP_002325737 predicted protein [Populus trichocarpa]1993e-014

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9FFQ0 Gb|AAF26070.12711e-022
B9RHN5 Hepatocyte growth factor-regulated tyrosine kinase substrate, putative2119e-016
B9IP43 Predicted protein1992e-014
B9N5B3 Predicted protein1912e-013
B6TCP0 Protein transporter1761e-011

Arabidopsis top hits (Blast detail)Scoree value
AT5G63640.1 VHS domain-containing protein / GAT domain-containing protein2723e-025

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  100%

Unigene Members