Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN75587

FASTA Sequence
Unigene ID: UN75587Length: 437 SSR 
CTACGGATTATGTATCTTAAACAGCAAAAAATACATTTTACATTACAGGAACAGCCAACAAAGATCATAGAGATTAAACAACAACA
ACAACAGCTTATGATCTTACACATGTTATAAAAACAAAAAAACCAAAATCTTTCCGGTCTCCAAGTCCTAAAACCCCTTCACAAAG
GTTGTTGAAAAGTAACCACCAAGGGACTTGTCACATTTCGTTTCCCATCCGACCAAACTATATGACCAGTCTCAACACTTGTCGCT
CCTGGGGACAGTTTCACCTCCGTAGTCTTAACCCTAACCACAAAACTCAGTTTCTGCCCCACCCGTCGGAACGATAGCTTCTCCGG
CTTAACCGCCACCGTCGTCCCTCTCGGGGGCCTAATCTTAACCTCATAAACAGAGTCTGAACCGCCAACATTTGTCACTGTCCTAA
TGAAATG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_566483 Subtilase family protein [Arabidopsis thaliana]4323e-041
AAL32016 AT3g14240/MLN21_2 [Arabidopsis thaliana]4323e-041
AAK25839 putative subtilisin serine protease [Arabidopsis thaliana]4323e-041
AAM60964 subtilisin-like serine protease [Arabidopsis thaliana]4296e-041
XP_002885025 hypothetical protein ARALYDRAFT_478841 [Arabidopsis lyrata subsp. lyrata]4233e-040

Swiss-Prot top hits (Blast detail)Scoree value
Q9LLL8 Xylem serine proteinase 11581e-010
O65351 Subtilisin-like protease1202e-006

TrEMBL top hits (Blast detail)Scoree value
Q8W554 AT3g14240/MLN21_24322e-041
Q9C5N5 Putative subtilisin serine protease4322e-041
Q9LUM3 Subtilisin proteinase-like protein4322e-041
Q8LGA0 Subtilisin-like serine protease4294e-041
B9N7H6 Predicted protein3391e-030

Arabidopsis top hits (Blast detail)Scoree value
AT3G14240.1 subtilase family protein4331e-043
AT1G32940.1 SBT3.5; identical protein binding / serine-type endopeptidase1661e-012
AT4G21326.1 ATSBT3.12 (SUBTILASE 3.12); identical protein binding / serine-type endopeptidase1642e-012
AT4G10510.1 subtilase family protein1615e-012
AT4G34980.1 SLP2; serine-type peptidase1615e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  100%

Unigene Members