 |
Information for unigene UN75731
FASTA Sequence |
Unigene ID: UN75731 | Length: 760 |
SSR | | GGGTCTGCAACAAGAACTACAACTTCAACGGTCCTCCAATTCCTCAATGTGTGAGTAACTTCCAAACATGTTCTATATTAGTGCCT
CGCTTCTTCGGACGCTTGACGTTGGCTACAACCGACTAACCGTAAATCTTCCAAGGTCGCTTCAACGCTGCTCCTCTTTAATCTCT
CCAAATGTTGACAACAACAACAACAACAACATCACTACACCAACAGCTACTCTCAACCATTTGATCAACGTTCACTTGCGGCGGCA
CGACGATGACGGTTTGGTGGAAGCACGCAGGCTATTTAATCAGAACCGGACATCGACGACATCGCTAGACATCTCAACATGGAACG
CGATGATCTCAGCCTACGTTCAGCGCGGCTTGATGACGGGAGCTCGCCAGGTGTTCGATCAAATGCCTGTGAGAGACTTGGCGTCG
TGGAACACCATGCTCATTGGTCTGAAGAAAGCCAGAGATGATCCAGAGAGTGTTATCAGGCTTTTCATAGATATGCGGAGATCATC
GTTGAATCCAGACGAGCTTACTCTCCCCGCGGTGATCGATGCTGCAGTATCAGTATCAGTATCAGGATCTGCGTTTTTCTTTAGGG
CTCTTGTTCTGCAGATTCACGCGCTTGCTATTCGGTTAGGGCTTAGCTCAAGCTCTGCTTTGTTGAGAGGCTACACGAGTTTAAGG
GATGTGAGAGTTTAGAGAGAGTCTTTGAGAGATCTCGGTCAAGATGTGGTGTCTGGAATGTGTTGATACGGT
|
|
|
GenBank top hits (Blast detail) | Score | e value |
NP_187126 pentatricopeptide repeat-containing protein [Arabidopsis thaliana] | 171 | 2e-010 |
XP_002519368 pentatricopeptide repeat-containing protein, putative [Ricinus communis] | 167 | 7e-010 |
BAD37262 pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa Japonica Group] | 160 | 4e-009 |
NP_001057211 Os06g0228900 [Oryza sativa Japonica Group] | 160 | 4e-009 |
XP_002884467 pentatricopeptide repeat-containing protein [Arabidopsis lyrata subsp. lyrata] | 160 | 4e-009 |
Swiss-Prot top hits (Blast detail) | Score | e value |
Q9SR01 Pentatricopeptide repeat-containing protein At3g04750, mitochondrial | 171 | 1e-011 |
Q9M9R6 Pentatricopeptide repeat-containing protein At1g14470 | 162 | 1e-010 |
Q9SKQ4 Pentatricopeptide repeat-containing protein At2g21090 | 159 | 3e-010 |
Q9C8L6 Pentatricopeptide repeat-containing protein At1g53600, mitochondrial | 156 | 6e-010 |
Q1PEU4 Pentatricopeptide repeat-containing protein At2g44880 | 155 | 7e-010 |
TrEMBL top hits (Blast detail) | Score | e value |
B9S049 Pentatricopeptide repeat-containing protein, putative | 167 | 4e-010 |
Q0DDE8 Os06g0228900 protein | 160 | 3e-009 |
Q67WJ3 Pentatricopeptide (PPR) repeat-containing protein-like | 160 | 3e-009 |
Q0WVP2 Putative uncharacterized protein At1g13410 | 159 | 4e-009 |
Q9FX57 T6J4.15 protein | 159 | 4e-009 |
Arabidopsis top hits (Blast detail) | Score | e value |
AT3G04750.1 pentatricopeptide (PPR) repeat-containing protein | 171 | 1e-012 |
AT1G14470.1 pentatricopeptide (PPR) repeat-containing protein | 162 | 1e-011 |
AT1G13410.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02750.1); Has 13539 Blast hits to 4793 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 35; Plants - 13298; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). | 159 | 2e-011 |
AT2G21090.1 pentatricopeptide (PPR) repeat-containing protein | 159 | 2e-011 |
AT1G53600.1 pentatricopeptide (PPR) repeat-containing protein | 156 | 5e-011 |
EST library breakdown for ESTs in the assembly |
Library |
ESTs | Percentage of ESTs in assembly |
|
|
Unigene Members | |
 |
|
|