Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN75731

FASTA Sequence
Unigene ID: UN75731Length: 760 SSR 
GGGTCTGCAACAAGAACTACAACTTCAACGGTCCTCCAATTCCTCAATGTGTGAGTAACTTCCAAACATGTTCTATATTAGTGCCT
CGCTTCTTCGGACGCTTGACGTTGGCTACAACCGACTAACCGTAAATCTTCCAAGGTCGCTTCAACGCTGCTCCTCTTTAATCTCT
CCAAATGTTGACAACAACAACAACAACAACATCACTACACCAACAGCTACTCTCAACCATTTGATCAACGTTCACTTGCGGCGGCA
CGACGATGACGGTTTGGTGGAAGCACGCAGGCTATTTAATCAGAACCGGACATCGACGACATCGCTAGACATCTCAACATGGAACG
CGATGATCTCAGCCTACGTTCAGCGCGGCTTGATGACGGGAGCTCGCCAGGTGTTCGATCAAATGCCTGTGAGAGACTTGGCGTCG
TGGAACACCATGCTCATTGGTCTGAAGAAAGCCAGAGATGATCCAGAGAGTGTTATCAGGCTTTTCATAGATATGCGGAGATCATC
GTTGAATCCAGACGAGCTTACTCTCCCCGCGGTGATCGATGCTGCAGTATCAGTATCAGTATCAGGATCTGCGTTTTTCTTTAGGG
CTCTTGTTCTGCAGATTCACGCGCTTGCTATTCGGTTAGGGCTTAGCTCAAGCTCTGCTTTGTTGAGAGGCTACACGAGTTTAAGG
GATGTGAGAGTTTAGAGAGAGTCTTTGAGAGATCTCGGTCAAGATGTGGTGTCTGGAATGTGTTGATACGGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_187126 pentatricopeptide repeat-containing protein [Arabidopsis thaliana]1712e-010
XP_002519368 pentatricopeptide repeat-containing protein, putative [Ricinus communis]1677e-010
BAD37262 pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa Japonica Group]1604e-009
NP_001057211 Os06g0228900 [Oryza sativa Japonica Group]1604e-009
XP_002884467 pentatricopeptide repeat-containing protein [Arabidopsis lyrata subsp. lyrata]1604e-009

Swiss-Prot top hits (Blast detail)Scoree value
Q9SR01 Pentatricopeptide repeat-containing protein At3g04750, mitochondrial1711e-011
Q9M9R6 Pentatricopeptide repeat-containing protein At1g144701621e-010
Q9SKQ4 Pentatricopeptide repeat-containing protein At2g210901593e-010
Q9C8L6 Pentatricopeptide repeat-containing protein At1g53600, mitochondrial1566e-010
Q1PEU4 Pentatricopeptide repeat-containing protein At2g448801557e-010

TrEMBL top hits (Blast detail)Scoree value
B9S049 Pentatricopeptide repeat-containing protein, putative1674e-010
Q0DDE8 Os06g0228900 protein1603e-009
Q67WJ3 Pentatricopeptide (PPR) repeat-containing protein-like1603e-009
Q0WVP2 Putative uncharacterized protein At1g134101594e-009
Q9FX57 T6J4.15 protein1594e-009

Arabidopsis top hits (Blast detail)Scoree value
AT3G04750.1 pentatricopeptide (PPR) repeat-containing protein1711e-012
AT1G14470.1 pentatricopeptide (PPR) repeat-containing protein1621e-011
AT1G13410.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 8 growth stages; CONTAINS InterPro DOMAIN/s: Pentatricopeptide repeat (InterPro:IPR002885); BEST Arabidopsis thaliana protein match is: pentatricopeptide (PPR) repeat-containing protein (TAIR:AT4G02750.1); Has 13539 Blast hits to 4793 proteins in 111 species: Archae - 0; Bacteria - 0; Metazoa - 25; Fungi - 35; Plants - 13298; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink).1592e-011
AT2G21090.1 pentatricopeptide (PPR) repeat-containing protein1592e-011
AT1G53600.1 pentatricopeptide (PPR) repeat-containing protein1565e-011

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
101  100%

Unigene Members