Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN76507

FASTA Sequence
Unigene ID: UN76507Length: 324 SSR 
AAAATAGAAGTCTTTAAATATTATTAAAGGAGTGAGCTTAGTGATACAAAGCCTCCTATGATGCAATTATTTCATCTTTTACAGAA
GTTTTATAATAAAATGTTTAAGACACAGAAGTCAAGAAGAAGAAGAAGACAGAAGTGAAGCCACTTCTCTTCTAAGGAAAGTAGGC
AAAGCGAAAGCTGCTCTGTGCATATCCGAGTTGTAAAACTTCATTTCTCGCTTATAGGTCATGGCACCGTCTAGTTTCTCAATAGG
GTTGATTGGGTTCTTGGAATCAACAGCGGGACCGCCCGTAAAGCACAAGATAAAACCAATCACGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAB08415 spermidine synthase [Arabidopsis thaliana]3024e-026
AAL11565 AT5g53120/MFH8_5 [Arabidopsis thaliana]3024e-026
AAM64782 spermidine synthase [Arabidopsis thaliana]3024e-026
NP_568785 Spermine synthase [Arabidopsis thaliana]3024e-026
BAH19534 AT5G53120 [Arabidopsis thaliana]3024e-026

Swiss-Prot top hits (Blast detail)Scoree value
O48659 Spermidine synthase 21802e-013
Q96556 Spermidine synthase 11792e-013
O82147 Spermidine synthase1783e-013
O48658 Spermidine synthase 11757e-013
Q9ZTR1 Spermidine synthase 11722e-012

TrEMBL top hits (Blast detail)Scoree value
B9DFL7 AT5G53120 protein3023e-026
Q8LBG3 Spermidine synthase3023e-026
Q944S0 AT5g53120/MFH8_53023e-026
Q94BN2 Putative spermidine synthase3023e-026
Q9FGM4 Spermidine synthase3023e-026

Arabidopsis top hits (Blast detail)Scoree value
AT5G53120.1 SPDS3 (SPERMIDINE SYNTHASE 3); spermidine synthase/ spermine synthase3021e-028
AT5G53120.2 SPDS3 (SPERMIDINE SYNTHASE 3); spermidine synthase/ spermine synthase3021e-028
AT5G53120.3 SPDS3 (SPERMIDINE SYNTHASE 3); spermidine synthase/ spermine synthase3021e-028
AT5G53120.4 SPDS3 (SPERMIDINE SYNTHASE 3); spermidine synthase/ spermine synthase3021e-028
AT5G53120.5 SPDS3 (SPERMIDINE SYNTHASE 3); spermidine synthase/ spermine synthase3021e-028

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  100%

Unigene Members