Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN76526

FASTA Sequence
Unigene ID: UN76526Length: 647 SSR 
GGACTTCTTAATGAGGTTATATTATTATTATTATAAGTATCAGTCTTCCCTCTTCATATAGATAAATTCATCATTCATATGAGAAT
GTCAAAAGCTTAACAGTTTCTTTTGCTCTCCCCTTTTCTCTCTATAACAAAATGCTTCTCTCTTAAAGTCCCCCATCTGCTGTGCT
TTCTTCTTCATGATTATTCTCTGTTTCCTCCTCCTCCTGATCAGCCTTCCATTCCATAATAGCTAGAGTGTGTCGACCCCCACATG
CCACAAACTTAGCTATCCACTTTCCATCCTCTTCTTCATCTGCGTGGTTAAACTGTCCTTCAGGTGGTGGAATCTCTATAGGAAGC
TCTGATGGTTGTCCCGTCGTCACTTTTCTTCCATACCCGAGTCTACCATGGTCTCCCCTACCAAACGAGAAGATCCTACCGTCTCT
TGTCTAAGCAACTGAATGAGTTCCACCACATGAGACCTGAATGATGTTTTCTACAGCCAAGAGATTGACTTTCTGTGGAACCATTT
TGCTGCTCTTGTCATTGTCACCAAACCCAAGCCTACCATGTTCCCCTCTTCCCCAAGCATACACCTCTCCTTGTTCGGTTAAAGCT
GTTGAATGCCATCCACCAGCAACTATATCAACCAAAGTGAGATCA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_197108 regulator of chromosome condensation repeat-containing protein [Arabidopsis thaliana]7267e-075
AAM61698 UVB-resistance protein-like [Arabidopsis thaliana]7213e-074
XP_002873752 regulator of chromosome condensation family protein [Arabidopsis lyrata subsp. lyrata]7114e-073
XP_002884323 regulator of chromosome condensation family protein [Arabidopsis lyrata subsp. lyrata]7105e-073
NP_186900 regulator of chromosome condensation domain-containing protein [Arabidopsis thaliana]7007e-072

Swiss-Prot top hits (Blast detail)Scoree value
Q15751 Probable E3 ubiquitin-protein ligase HERC12254e-018
Q9VR91 Probable E3 ubiquitin-protein ligase HERC22183e-017
O95714 E3 ubiquitin-protein ligase HERC22067e-016
Q4U2R1 E3 ubiquitin-protein ligase HERC21994e-015
Q8IVU3 Probable E3 ubiquitin-protein ligase HERC61951e-014

TrEMBL top hits (Blast detail)Scoree value
Q9LFS0 At5g160407265e-075
Q8LEY9 UVB-resistance protein-like7212e-074
Q2V3Z2 Putative uncharacterized protein At3g025107005e-072
Q1KUV8 Putative uncharacterized protein6711e-068
B9RSM6 Ran GTPase binding protein, putative6226e-063

Arabidopsis top hits (Blast detail)Scoree value
AT5G16040.1 regulator of chromosome condensation (RCC1) family protein7263e-077
AT3G02510.1 regulator of chromosome condensation (RCC1) family protein7003e-074
AT3G02510.2 regulator of chromosome condensation (RCC1) family protein2882e-026
AT5G63860.1 UVR8 (UVB-RESISTANCE 8); chromatin binding / guanyl-nucleotide exchange factor1815e-014
AT5G08710.1 regulator of chromosome condensation (RCC1) family protein / UVB-resistance protein-related1807e-014

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
111  100%

Unigene Members