Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN77835

FASTA Sequence
Unigene ID: UN77835Length: 456 SSR 
GGCTGGAGAGCATCAACAAACCACAAAGAGATAGAGAGAGAAAAAAATATTTCGAAAGAGAACCCCAAAGAAGCTAGTTATTTACA
GTTTCGCCGCTAATTTTACATATCTGAGCATTTCAACACCGCCATGTGTGGAGGAGCTATAATCTCCGATTTCATCCCTCCGCCGA
GGTCCCGCCGCGTCACGAGCGAGTTCATCTGGCCGGATCTGAAAAAGAAAGGGAAAGCTTCGAAGAAGAAGCGATCCGATTTCCTC
GATCTGGAGGATGAGTTCGAGGCTGACTTTCAAGGGTTTAAGGATGATTCATCTTTCCACTGCGAAGAAGAAGATGAATTCGACGC
TGATGATGATGATGATGTCTTCGCCGATGTTAAGCCCTTTGTTTTCACCGCAGGTCCAGTTTCTGGCATAGAGTCTGGTGGGCAAG
CTGAGAAATGTGCTAAGAGAAAGAGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34297 unnamed protein product [Thellungiella halophila]3623e-033
BAJ33606 unnamed protein product [Thellungiella halophila]3534e-032
NP_850583 ethylene-responsive transcription factor RAP2-2 [Arabidopsis thaliana]3508e-032
NP_850582 ethylene-responsive transcription factor RAP2-2 [Arabidopsis thaliana]3481e-031
NP_566482 ethylene-responsive transcription factor RAP2-2 [Arabidopsis thaliana]3481e-031

Swiss-Prot top hits (Blast detail)Scoree value
Q9LUM4 Ethylene-responsive transcription factor RAP2-23481e-032
Q9SSA8 Ethylene-responsive transcription factor RAP2-123382e-031

TrEMBL top hits (Blast detail)Scoree value
A8MRL7 Uncharacterized protein At3g14230.33506e-032
B9DG10 AT1G53910 protein3381e-030
A8MRC0 Uncharacterized protein At1g53910.33353e-030
C6K6J7 Ethylene signal transcription factor2816e-024
Q3L0R1 Ethylene-responsive element binding protein ERF22726e-023

Arabidopsis top hits (Blast detail)Scoree value
AT3G14230.3 RAP2.2; DNA binding / transcription factor3507e-034
AT3G14230.1 RAP2.2; DNA binding / transcription factor3481e-033
AT3G14230.2 RAP2.2; DNA binding / transcription factor3481e-033
AT1G53910.1 RAP2.12; DNA binding / transcription factor3382e-032
AT1G53910.2 RAP2.12; DNA binding / transcription factor3382e-032

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  100%

Unigene Members