Information for unigene UN78167
| FASTA Sequence |
| Unigene ID: UN78167 | Length: 198 |
SSR | | CGTACGTTACAACAAAAACCATCTAAAAAATTGTCTGAATAAACGATACTTCAGTTCTCAAACAGGAAAAACAAAAAAAAACATAA
CACCTAGTAATCTCTCTCTCTCATTGATCACTCTTCATCAGGCTTCTTGAAAACATAAGTGGTTCCCCACTTGCCACAGTAATGCC
TATCGAAATGACTCCCCATGAACGTC
|
|
|
| GenBank top hits (Blast detail) | Score | e value |
|---|
| NP_173755 40S ribosomal protein S27a-1 [Arabidopsis thaliana] | 136 | 8e-007 |
| XP_002890580 hypothetical protein ARALYDRAFT_472603 [Arabidopsis lyrata subsp. lyrata] | 136 | 8e-007 |
| Swiss-Prot top hits (Blast detail) | Score | e value |
|---|
| P59271 40S ribosomal protein S27a-1 | 136 | 3e-008 |
| Arabidopsis top hits (Blast detail) | Score | e value |
|---|
| AT1G23410.1 ubiquitin extension protein, putative / 40S ribosomal protein S27A (RPS27aA) | 137 | 2e-009 |
| AT3G62250.1 UBQ5 (ubiquitin 5); protein binding / structural constituent of ribosome | 109 | 3e-006 |
| AT2G47110.1 UBQ6; protein binding | 108 | 4e-006 |
| EST library breakdown for ESTs in the assembly |
| Library |
ESTs | Percentage of ESTs in assembly |
|
|
| Unigene Members | |
 |
|
|
