Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN78581

FASTA Sequence
Unigene ID: UN78581Length: 213 SSR 
GGACAACAGATCTAACCCTTCCCGCGTCACTGATTTTTTCTCTCGCTCTCTCCCGACGGTACCGATGTTTAGCGTGGAAGAAGGAA
GCAGCGGAGGAGACGCCGGCTCCGAGATGGACGATGAGATAACCGGAGACGGTTCCACGACGTCCTTGTCGCGCTGGGTCTTCGAC
GAGAAGAACGATTACGACGCGATCGACGACGACGACGATTA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195079 Potassium transporter 13 [Arabidopsis thaliana]1672e-010
CAB80070 putative potassium transporter AtKT5p (AtKT5) [Arabidopsis thaliana]1672e-010
CAA20566 putative potassium transporter AtKT5p (AtKT5) [Arabidopsis thaliana]1672e-010
XP_002867173 hypothetical protein ARALYDRAFT_913065 [Arabidopsis lyrata subsp. lyrata]1672e-010

Swiss-Prot top hits (Blast detail)Scoree value
Q8LPL8 Potassium transporter 131677e-012

TrEMBL top hits Scoree value
No hits found  

Arabidopsis top hits (Blast detail)Scoree value
AT4G33530.1 KUP5; potassium ion transmembrane transporter1675e-013

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  100%

Unigene Members